William Shakespeare’s “Julius Caesar” Plot Analysis

Just like all the other stories, the â€Å"Julius Caesar†, written by William Shakespeare, includes the following basic sections: the initial situation, the story conflict, climax, suspense and conclusive part. William Shakespeare didn’t go any other way, and made his â€Å"Julius Caesar† on the basis of typical â€Å"ingredients†. Initial Situation After killing his co-leader Pompey Julius Caesar returns to Rome. The whole irony lies within fact that common people celebrate the Roman triumph of an individual instead of the whole nation. The tension feels from the first page of the page and without a doubt, something is going to happen so that the tension could be finally broken. Conflict of the Story Julius Caesar’s longing for an absolute power disturbs those who believe that common people ignore the possible consequences of the upcoming of Julius Caesar’s tyranny. Although Cassius exerts every effort to incite Brutus to rebel, Brutus takes no notice of it and is moved by the fact that the empire should be greater than Julius. With the fake letter in his hands, Brutus realizes how bad the things are in Rome and that he is the only savior. His patriotic feelings must be higher than personal convictions regarding Julius Caesar. Complication The conspirators come to an agreement that nobody should touch the Antony’s body that worries Cassius. The conspirators easily pull off the murder, nonetheless, they are hurt by naive beliefs of Brutus. He truly believes that everyone around will worship them after they state real motivations behind their deeds: that they killed Julius Caesar only to bring the better future for Rome. The nation is all in panic, which means things went really wrong. Playing with Brutus’s trust, Anthony asks him whether he can deliver his speech at the funeral. Although Antony gives his word by saying he will never lay any blame, he actually plans to have Julius avenged by provoking the common people to start a riot. Climax Antony’s rhetoric gives him an opportunity to highlight all the wrongs the traitors have done to Julius Caesar. This gives the people a good motivation to be angry on Julius Caesar’s behalf. They walk the streets, shouting â€Å"Kill and burn!†. The whole situation pleases Antony. whose plan turns out just perfectly. Denouement Everyone finally â€Å"wakes up† when Brutus announces that Portia is dead. This, in turn, brings some light on how useless was Brutus in this fight. Julius Caesar’s ghost appears and Brutus, being braver than ever before, is sure to meet the ghost. Cassius sums up his life in a very poetic way – his birthday comes, so if he passes away today, this means his life have reached the full circle. Two comrades agree to never come back in chains, which means that they will commit suicide before the moment of dishonor. Finale When reaching up the end of the play, one sees how it all played in the world history. Cassius and Brutus commit suicide when they are sure their battle against Antony is lost. Having taken the field, where Brutus fell, Antony and Octavius proclaim him to be the noblest man. Unluckily, Brutus is a little bit too dead to know his new status and the situation doesn’t worry him anymore. This was an example of Julius Caesar essay, written by the writers of our custom writing service. To buy an essay on the necessary topic, please, fill in the Free Inquiry form in the top right corner of this page.

Vark Questionnaire - 906 Words

VARK Analysis Paper Elaine Boyd Grand Canyon University May 24, 2015 VARK Analysis Paper According to the VARK questionnaire the learning strategy that best describes this student’s style is multimodal learning style. Experience has shown this person learning to be strongest in visual and kinesthetic and less in the aural and read/write styles. Amazingly, this corresponds with the results of this questionnaire. Multimodal learning style means that all styles are used to some degree. Many people find they need the same material taught using several of the learning modes to grasp the meaning of the subject being taught. This finding is very accurate looking on past experiences with understanding of written instructions†¦show more content†¦Knowing their particular learning styles(s) should encourage student/patient self-enhancement. It is also important for each individual be not only knowledgeable of their learning preferences but to practice other styles to enhance their learning abilities. It is believed this encourages well rounded education and learning. Educators teach best when they use a variety of learning styles to assure all students comprehend the material provided. â€Å"Most nursing students can learn effectively as long as the instructor provides different learning activities (Visual, Auditory, Read/Write, and Kinesthetic). (AIKhasawneh, 2013, p. 1549)†. There are other attributes which aides in learning such as room temperature, lighting, sound and allowing breaks for students to absorb information that instructors need to consider when teaching. Providing time for learners to absorb information, discuss lecture with others and replenish nutrition are necessary for instructors to keep in mind. In conclusion, it is wise to discover your preferred learning style to enhance education and make you a better teacher/student. Passing along this information to others may encourage them to learn as they discover the style which best suits them. Important also is to realize patients need to be assess ed for their best learning style. References AIKhasawneh, E. (2013, December, 2013).Show MoreRelatedVark Questionnaire Paper860 Words   |  4 Pagesâ€Å"VARK† is a questionnaire of about 16 questions that provides people with their preference of learning style. The learning styles that VARK offers can help people develop additional and effective strategies for learning and for making your communication skills better. The styles that this questionnaire determines are Visual, Aural, Read/Write, Kinesthetic, or you can be multimodal which means you have a multiple learning preference. In this paper I will summarize the results received after takingRead MoreThe Analysis : The Vark Questionnaire987 Words   |  4 PagesVARK Analyze Paper: The VARK Questionnaire According to Marcy (2001), â€Å"Learning styles† is a term used to refer to the way someone gathers, process, interprets, organizes, and thinks about information. However, each person has a different style or preference of learning, and being able to identify or understand someone’s learning styles is very important in the learning or teaching process. In the Fleming’s model, also known as VARK, an acronym stands for Visual, Auditory/aural, Read/write, andRead MoreResults of the VARK Questionnaire812 Words   |  3 PagesVARK Questionnaire The results of my VARK questionnaire indicate that I have a mild Read/Write preference, although my aural score was nearly as high as this. This means that I best learn by reading instructions and I feel most comfortable helping others by writing them. Reading and writing (R W) is my preferred mode of information acquisition because this is the way I best understand and interpret data. Rather than learning to someone explain something, or see a demonstration, or look atRead MoreEssay about The Vark Questionnaire: How Do I Learn Best?597 Words   |  3 PagesThe VARK Questionnaire: How Do I Learn Best? VARK questionnaire is composed of many fundamentals that associated with people’s preferred learning styles. VARK questionnaire help leaners identify their specific learning methods to focus on learning material with important segments. Any profession can use VARK learning methods to teach or introduce study materiel to their associates. The VARK questionnaire is based on four scores and there are five different learning strategies and they are, multimodalRead MoreEssay about Vark Learning Style Analysis1006 Words   |  5 PagesRunning head: VARK LEARNING STYLE ANALYSIS VARK Learning Style Analysis Kathleen Nash Grand Canyon University NRS-429V, Family Centered Health Promotion July 22, 2012 VARK Learning Style Analysis The VARK learning preference tool provides individuals with information that they can utilize to enhance their learning process by helping them to study more effectively and efficiently. The VARK tool consists of a questionnaire that the learner takes to identify which senses the individualRead MoreVark Analysis Paper1109 Words   |  5 PagesVARK Analysis Paper Rebecca Rivera Grand Canyon University July 23, 2016 Abstract The acronym VARK stands for visual, aural, read and kinesthetic comprised if 16 question to analysis and gain a better understanding of personal learning styles (VARK a guide to learning styles, 2016). Understanding of personal learning style aids in the ability to teach others in a variety of styles to ensure that the learner has an understanding on new information. An analysis of an individual study willRead MoreVark Analysis Paper1144 Words   |  5 PagesThe VARK Learning Style Assessment was designed by Neil Fleming in 1987. VARK stands for Visual, Aural, Read/write, and Kinesthetic sensory modalities that are used for learning information. His assessment is a questionnaire that asks an individual 16 questions pertaining to how they like to learn new information, specifically how they like to take in information, use it for effective learning and communicate this information to others effectively. Once an individual completes the questionnaireRead MoreVark Learning Styles807 Words   |  4 PagesLearning strategies and VARK analysis Dictionary.com defines a student as â€Å"a person formally engaged in learning† (Student, 2012). Students of any age know that comprehending and retaining information is essential to educational success. Just as every student had unique physical attributes, they also have unique learning styles in which they best retain new and important information. The VARK (Visual, Aural, Read/Write, and Kinesthetic) is a questionnaire that is given to help individual findRead MoreVark Assessment1111 Words   |  5 PagesVark Analysis Lindsay Williams Grand Canyon University The Vark assessment tool is a questionnaire that will provide the user with an understanding about the type of learner they are, and what are the most useful resources to for maximum learning. The questionnaire consists of 16 questions which are aimed at isolating a learner’s preference to give them a better understanding of what is most effective for their retention of information being taught. According to the Vark questionnaire, thereRead MoreWhat Does It Can Help Teachers Design And Deliver Instruction That Meets Different Learning Styles And Preferences Essay1074 Words   |  5 PagesLESSON DESCRIPTION VARK is a fun, short, simple inventory with lots of practical educational applications. In this lesson, we will discuss how it can help teachers design and deliver instruction that meets different learning styles and preferences. !!!What is VARK? How many times have you hear students say, â€Å"I just don’t get it!† It is always important to try to provide instruction that addresses student learning styles. As a teacher, you already try to modify instruction so that all your students

Reviews Writing For Essay Sharks Example For Students

Reviews Writing For Essay Sharks Its tail swayed slowly from side to side, pushing the hunters bodythrough the murky water. All signs of motion were non-existant, except for therhythmic movement of the water over the five gill slits on either side of itshead. Slowly gaining speed, the shady figures unmoving eyes fixed on itstarget, a lost harbor seal pup. As the distance between the predator and itsprey grew closer, the jaws of the massive fish drew forward, exposing nearlyeight rows of razor sharp teeth. Strings of its previous meal hung in rowsfrom between its teeth. Sensing danger, the harbor seal frantically tried tofind a place to seek refuge, but it was too late. The jaws of the shark closedaround the seal with an astounding 14,000 pounds of pressure, cutting the sealin half. The Great White shark claims another victim.1Any one whos seen the famous movie series Jaws may look at the GreatWhite Shark in a similar manner. Perhaps its the way that Hollywood uses a mixof fact and fiction in the series. This may hav e frightened many people intohating the Great White for its ferocity. It might have also been the size ofthe shark in the movie thats kept thousands of people off the beaches and outof the water. Better yet, it could have been the overall storyline: A GreatWhite shark with an eating disorder and a taste for human flesh. Perhaps thatswhat is keeping vacationers from grabbing their trousers and snorkels. Over all, there have been 1026 attacks on humans by sharks in the lastten years. Only 294 of these attacks have been linked to Great White sharks. Thats roughly the number of people who drown each year in swimming accidents. Of these 294 attacks, less than eighteen percent were fatal. Out of theeighteen fatal incidents more than seventy percent was contributed to loss ofblood. This means that the shark didnt kill the victim. The shark bit thevictim and then released them (also known as the taste test). The shark samplesthe victim by nibbling on an appendage or two often resulting in a severedartery or other major blood vessel. Therefore, the Great White should beconsidered a mantaster not a maneater. This intrigued scientists considering the size of the sharks brain. TheGreat Whites brain is about one half the size of a dogs. Over seventy percentof the brain is used for tracking prey. The other thirty percent is used forbody functions. Studies show that the sharks main purpose is to eat. Peoplethink that the sharks main purpose is to kill. This is incorrect, sharks onlyeat when they are hungry. Impulses from the brain are sent to the jaws and thestomach telling the shark that it is time to hunt for food. Why do sharks not follow a basic attack pattern on a human? In a humanattack, the primary strike is usually the only contact, as though the sharkfinds us(humans) to be unpalatable. There is a theory on this as well,involving the differences in our anatomy and the pinnipeds(seals, sea lions). We are mostly muscle where the pinniped body has a great deal of fat. It istheorized that the shark somehow senses this and abandons us as a potential mealbecause our bodies are not as energy-rich as the pinnipeds. Of course, this isoften enough to kill us or at least, really screw up our day!Cold Hard FactsThe Great White shark has remained unchanged for 250 million years. Its greek name is Carcharodon carcharias. This is derived from carcharos meaning ragged and odon meaning tooth. There isnt a defined size range for theGreat White but most experts agree that the length of the shark is usuallybetween 12 and 16 feet with the maximum figure being about19 to 21 feet. (The 21foot is an actual record from 1948. The largest ever recorded!) If the GreatWhite is that big try to imagine the size of those massive jaws and teeth, Notto mention the enoromous power behind those jaws.. These huge eating machinesused to be even bigger! The Great White was once known as Carcharodon megalodon. .ue205c693f4432da129a858855b212880 , .ue205c693f4432da129a858855b212880 .postImageUrl , .ue205c693f4432da129a858855b212880 .centered-text-area { min-height: 80px; position: relative; } .ue205c693f4432da129a858855b212880 , .ue205c693f4432da129a858855b212880:hover , .ue205c693f4432da129a858855b212880:visited , .ue205c693f4432da129a858855b212880:active { border:0!important; } .ue205c693f4432da129a858855b212880 .clearfix:after { content: ""; display: table; clear: both; } .ue205c693f4432da129a858855b212880 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .ue205c693f4432da129a858855b212880:active , .ue205c693f4432da129a858855b212880:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .ue205c693f4432da129a858855b212880 .centered-text-area { width: 100%; position: relative ; } .ue205c693f4432da129a858855b212880 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .ue205c693f4432da129a858855b212880 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .ue205c693f4432da129a858855b212880 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .ue205c693f4432da129a858855b212880:hover .ctaButton { background-color: #34495E!important; } .ue205c693f4432da129a858855b212880 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .ue205c693f4432da129a858855b212880 .ue205c693f4432da129a858855b212880-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .ue205c693f4432da129a858855b212880:after { content: ""; display: block; clear: both; } READ: LANDFILLS Solid waste is the term that civil engin EssayThe only difference in between the Great White and this previous model is size. The Carcharodon megalodon was MASSIVE compared to the modern day Great White. Averaging forty to forty-five feet in length, it is theorized that this

Adolescent Suicide Essay Example For Students

Adolescent Suicide Essay By: Jill Holmes E-mail: emailprotected Becoming a teacher, entering into a wonderful profession, also deals with many difficult issues. The problems faced by the adolescents of today has greatly changed, and even increased, from earlier times. Adolescent suicide is a dreadful, and ghastly problem that, as an educator, numerous will run into. It raises many questions: What are the statistics, and in what ways do children attempt to carry out a suicide? What are the reasons behind it? What are the warning signs to look for? Is there a difference between males and females? Does educating the children about suicide increase the rate? Are these children mentally ill or possibly depressed? What should be taken seriously? Is an attempt just seeking attention? What ways can a teacher, or a person close to them, help? The statistics, that scare any rational human being, involve a number and percentage that is much too large, and it is the second leading cause of death for adolescents among th e ages of 15 to 19. It is also the second for college students, with homicide being the third. It is the fourth leading cause for those 10 to 14 years old, and the rate has more than tripled since the 1950s. As of September 1999, the rate was 13.8 per 100,000 children that committed suicide. For 10 to 14 year olds, from 1980 to 1992, it increased 120%. Although, over the last decade, it has gone up a total of 200%. Some of the ways these children either attempt or commit suicide depends on what is available. A myth that suicide is painless, glorifying it in the movies does not help, and it does not relate to the fact that many methods chosen are very painful. The reality is, pills, drugs, hangings, guns, or most of the many ways, involve agony and hurting. Having a firearm in the house also contributes to the chance that they will use it. Out of the suicide victims, ages 10 to 24, there are 64% that use a gun to complete the act. Just having a weapon in the house is not the cause of the suicide. The reasons behind the action vary greatly, but there are some life changes in an adolescents life that are very significant to them. It needs to be stressed that this emergency may not seem considerable to an adult looking at the situation, but is definitely meaningful to the child. It is not uncommon for young people to think about mortality, and even to wonder what effect their suicide would have on family and friends. These ideas, however, are not usually acted upon. The significant events in their life can be a crisis with their girlfriend or boyfriend all the way to a very negative remark or disposition from a parent or teacher. Anything in-between these, an important incident, can also trigger these thoughts or behavior. Students who have already had a lot of stress in their lives are going to be at a higher risk, also. Stressors include divorce, parent arguments, family difficulty, rejection, abuse, (physical and/or sexual), violence, (i.e. rape or incest), fea red pregnancy, and alcohol or drug misuse. A loss of a meaningful person, whether it is through death, divorce, a break up, or suicide, chronic depression or metal illness in parents or self, and pressure for perfection are all tension causing issues that may be the reason behind the suicide. Related to school, the main explanations are: being in trouble with school authorities or police from an incident in school, loss or disgruntlement in school, and strong demands from adults or teachers. The most important motive, for a teacher to watch for, may be a change in school and/or address and not fitting in well. Knowing all the reasons in the world will not help the individual if a teacher, adult, or peer does not recognize the warning signs. There are numerous indicators, and some also may suggest something else instead of suicide, but just looking for them will assist the student. Warning signs can include social withdrawal, a person who gives away personal possessions, a pupil who gives you a sealed envelope and asks for it not to be opened, depression or moodiness, and sudden changes in relationships. Examples of classroom behavior for educators to be aware of contain: a marked decline in school performance, death or suicide themes that appear in writing or artistic creations, loss of interest in school activities and previous enjoyable exertions, troublesome or rebellious behavior, poor concentration, skipping classes, sleepiness, and an incapability to accept compliments, praise, or rewards. Attempted suicides do not usually happen unexpectedly. There are signals to look for. Withdrawing, not wanting to be touched, sudden weight change, running away, not normal risk taking, loss of sense of humor, sexual promiscuity, an inability to enjoy friends, self-mutilation, and extreme dependency on a particular person are all warning symptoms to look for. A direct statement, such as, I wish I were dead, or Im going to end it all, are to be taken seriously for someo ne who is exhibiting other indicators. Also, indirect statements, No one cares whether I live or die, and Does it hurt to die?, are just as dangerous. Feelings of worthlessness, guilt, or failure are all large reasons that a person may commit suicide, and should be watched for. The warnings in children who attempt or act out suicides are not too different for males and females. Although there are some distinctions. The suicide rate for white males, ages 15 to 24, has tripled since 1950, but white females, same age group, has more than doubled. The rate for young black males, 15 to 24, has risen about 67%, in just the past 15 years. Adolescent males versus females, commit suicide at a startling ratio of 5 to 1. Females are more likely to have thought of suicide, 3 to 4 times more inclined to attempt it, and 1.5 to 2 times more likely to report a suicidal idea. Males are 4 to 5.5 times more prone to complete a suicide undertaking. Females only go through with a suicide one out of ever y 25 tries, and males are one in three. Females complete suicides at a lower rate, but this does not mean their attempts should not be taken just as seriously. One of the best indicators of a suicide is a prior try. The children that attempt just once, are eight times more likely to do it again. One-third of kids who kill themselves have a previous trial time. Regardless of gender, all times should be taken soberly and gravely. Educating, both males and females, on suicide does not increase the suicide rate of adolescents doing it. It is also a myth that talking about suicide or asking someone if they feel suicidal will encourage an attempt. It actually provides a communication base, and fears can be expressed. The first step in motivating someone to live is to talk about their feelings. This can be a simple question about whether or not the person is thinking about taking their life. It should, however, be carefully managed and delicately handled. If issues are taught in a sensitiv e context, education of suicide does not lead to, or cause, further suicidal behavior. This can be compared to passing out condoms at schools does not make students go out and have sex. Peer assistance programs, to educate students how to help a friend get support, are crucial since three-fourths of teenage students would turn to a friend first. The programs help pupils recognize people at risk, and it also increases their knowledge of warning signs. The warning signs for suicidal adolescents are many, but depression and mental illness can be a large contributing factor. There are recent studies that have shown more than 20% of adolescents in the United States suffer from a mental illness or have an emotional problem. One-third are attending physicians for treatment for depression. Although these numbers seem high, the ailment depression is generally under diagnosed, leading to difficulties in life, school, and common situations. Depression is often missed because adolescence is a t ime of moodiness, drama, sensitivity, behavior experimentation, and rebellion. It is a challenge to identify a depressed kid from a child who may just be going through the normal ups and downs of growing up. That is why it is up to teachers, parents, peers, and community to provide information to a psychiatrist when a child is under his/her care, and they are trying to diagnose depression. Trust is an important element that must be established for an adolescent to share his/her feelings, and the previous people mentioned already have that trust, unlike the doctor. It is a myth that kids that commit suicide are insane. They may experience depression, have a mood disorder, or be extremely unhappy, but majority are legally sane. Both depression and self-destructive behavior are common in adolescents. Self-destructive actions among this age group are on the rise. During the time the person actually commits suicide, there are 90% of the adolescents that have at least one diagnosable, act ive psychiatric illness, (usually depression, substance abuse, or a behavioral disorder). There is only 33% to 50% of suicide victims that have a mental illness at time of death, and only 15% were undergoing treatment when they take their life. The previous attempt, and what should be taken seriously, is an significant and substantial action for people to watch for. Many more teenagers and adolescents attempt suicide than actually succeed, and the first try may be naive. A minor attempt, however, is often perceived as just attention seeking, and no more notice is paid to it. If the person does not receive any relief from his/her situation, they will probably be a repeater. It is also likely that the method used, and the level of danger will increase with each further attempt. The statistics on this are: 26% to 33% of adolescent suicide victims have made a previous suicide try. Majority also usually feels torn to end their pain through death, and wanting to continue living. If help c an be found, and utilized, the rate of adolescent suicide will hopefully decrease. What are ways to help an adolescent in need? This is the most important question we have to answer. If you can assist a person who is thinking about committing suicide, and deter this act, you have saved a life. Recognizing changes in behavior, knowledge of warning signs, understanding risk factors, and intervening before the potentially destructive process completes itself are all parts of the aiding course. The duration and intensity of these factors are to be taken into consideration. Comparing one person to another will not work, you have to judge each case as special and individual. Stimulating conversation, helping them find appropriate counseling, asking if they are thinking about suicide, or if they have a plan, and then contributing to their development of a personal safety plan are ways to help. This personal safety plan is crucial in protecting that life. It can include time spent with othe rs, check-in points, plans for the future, and many other designs. They can help themselves. They can gain self-direction and self-management in their lives if they have caring and informative people around them. Adolescents in this situation do not always know the correct path to take to get there lives back under control. Managing their lives takes effort on their part, but also for the people helping them. Suicide is a permanent solution to a temporary problem, and it is common for the person to resent help at first. Usually in the long run, though, it is a relief for them to have someone care about them that much. It is also necessary to limit these peoples exposure to firearms, alcohol, and illicit substances. Media can also be something that needs to be supervised. Professional help needs to be located immediately after an adolescents suicide plans are discovered. There are three main forms of aiding those who want to end their life. A suicide crisis hot line, educational prog rams, and a screening are these formats. A suicidal person has two minds of whether they want to go through with it, and whether they want to live or die. It makes sense that if a person is having problems, a hot line that is inexpensive, anonymous, and convenient, would be a godsend. Education programs, mentioned earlier, can also be applied to parents, adults, and teachers. The systematic screening for disturbed students is a wonderful development. Studies show approximately 90% of teenagers who commit suicide have a psychiatric disorder. Finding these students is done by asking directly, and in confidence, whether they have thought about or attempted suicide. The questions are presented in such a way that the project staff can identify students with the most severe problems. Adolescents having problems and that are suicidal is a large problem in society today. It is a issue that teachers may unfortunately encounter during their career. The problems adolescents face are so numerou s, that sometimes they can not deal with them in the correct manner. There are statistics, reasons, warning signs, males versus females, education, depression and mental illnesses, attempts, and help available that all need to be looked at. Hopefully with education, teachers will be more prepared to deal with adolescent suicides. Word Count: 2223 Satire Essay

Poem She Sat Essays - , Term Papers, Research Papers

Poem: She Sat She sat... helpless in her room praying to whatever god there may be to let her call to him. could god ignore such a painful cry? darkness fills her windows... sneaking nearer to her bed. she calls out in the blackness, and then, once again. as other nights that have past... the blackness overwhelms her. with a single tear in each eye (that is all she has left). she sleeps. she awakens to the harshness of god's sunlight to find herself alone. Poetry

Patton essays

Patton essays Millions of men died during the Second World War and each of those men, civilians or soldiers, affected the war. But only a handful of those men greatly affected the war in such a way that they, with their leadership and decisions, determined the outcome of the war. These men were the leaders in the army's involved in World War II. One of those leaders influenced the war with a 'deeply religious and very profane way, with a mixture of what some say was like fire and ice.' Earning the nickname 'Old Blood and Guts' General George S. Patton Jr. used tactics unlike any other of his time. He was an educated man who went to Virginia Military Institute and then to West Point, which he graduated from. He not only knew his history but also could retell battles that very few knew. General Patton influenced the war in such a way that he helped win the war. General Patton was widely known for his war tactics and was called a Legend in his own time. People ether hated his guts or loved him because he knew how to win battles in his own unique way. He led his men through terrain unknown to him and in some cases weather conditions that were extremely hazards. During battles like the Battle of the Bulge he led his men throw snow without the right camouflage for his men or his tanks. He studied all the Great War leaders throughout time and used many of their strategies during battle. He was well known for knowing his history and respected for his knowledge. Patton loved his job. He took risks, which could have cost the lives of all his men, but with luck and great strategy he lost less men than planned. His casualties were lower than anyone could have expected even out of him. He loved his job so much he fought unlike any other General in the American, German, Italian, or British. No one loved war or being able to command as many men as Pat ton did. General Patton pushed his men hard to make them strive for victory. He gained the name 'Old ...

Operations Management Essay Example | Topics and Well Written Essays - 1500 words - 13

Operations Management - Essay Example The international nature that is evident in the markets as well as competition has made many of the companies that operate globally to make reviews to their operations strategy and the companies are thus moving from the centralized operations to the decentralized ones so that they can benefit from the accessible resources while being closer to the markets. The organizations have also made several changes in the approaches, techniques and operations they employ with the goal of meeting the evolving requirements associated with the market. Companies therefore have to be in competition on the basis of more than one competitive performance goals that include quality, cost, receptiveness, suppleness as well as reliability.Mass customization has therefore developed to be a key goal as in many of the companies and the organizations are developing the build-to-order supply chain so that it can be flexible and responsive. To accomplish mass customization, the build-to-order model has to be ac tively implemented in a variety of industries, company like BMW allows the customers to make changes to the vehicles that they want within six days of the final assembly and this includes an entire change in the colour of the car. This enables the company for example, to build more than half a million permutations of the Z3 since they can be tweaked to the customer’s specifications in the event that he or she wants adjustments.As a result of the escalating international competition as well as a decline in the profit margins.

Human Resource Management in the Hospitality Industry Thesis

Human Resource Management in the Hospitality Industry - Thesis Example However, leisure time is usually limited and thus valuable in our modern society and hence consumer expectation of the product or experience purchased in this time has subsequently risen vastly. Quality is of the essence, gone are the days of 'Fawlty Towers.' People expect and demand so much more from their hospitality experience. Ideas, tastes and trends of hospitality are expanding, one example being the recent growth of boutique type hotels such as the Malmaison chain located in up market urban areas, modern contemporary urban chic culture were the emphasis is on luxury (Aggett; 2007). Such an experience and its quality is thus very much dependant on the service provided by front line employees. Only those enterprises which can satisfy the customer will survive, achieve longevity and be successful in the ever growing intensely competitive hospitality market. Hospitality is characterised by the 'intangibles' which can even be of increased value in comparison to the tangible physical products such as food and drink. Therefore, within the hospitality industry it is undoubtedly the performance of the front line service staff that will either enhance or diminish a customers experience and thus determine whether a hospitality venture sinks or swims. In order for staff to perform to such high standards and produce such quality they need to be committed to their organisation, to be empowered, to be given the appropriate skills, training, support, motivation and reward for their work and effort. A company that invests heavily in its human resources, selecting the appropriate people, providing opportunity and encouragement will achieve a loyal, motivated and proud workforce. It will provide the organisational culture necessary for long term success. This is very important for the hospitality industry to acknowledge, especially as typically the industry is characterised by a high labour turnover, casual, part time and migrant employees, and, certain labour shortages; "Finding chefs and waiting staff is one of the biggest problems facing employers, affecting all sectors of the hospitality industry." (Hospitality Training Foundation; 2002, 9) Rowley and Purcell (2001) acknowledge a range of skill shortages and relate it to; "Poor management practices and weak HR policies." (Rowley and Purcell; 2001) Investment in HRM and adoption of HRM practices, particularly soft HRM (Lucas; 1995) would only be advantageous to the hospitality industry. 2 Aim of Research The aim of this paper is to establish if the UK hospitality has adopted the concept of HRM. The meaning of HRM will be based upon the pioneering work of British hospitality academic David Guest (1987, 1997, 1999) who devised a matrix to represent the scale of hard and soft HRM in operation. Guest's writings epitomise soft HRM. Guest also provides a theory and model of HRM, of which the intention was: "To develop a set of testable propositions and finally to arrive at a set of prescriptive policies" (Guest, 1987, 503). The central hypothesis of Guests' theory is: " if an integrated set of HRM practices is applied with a view to achieving the normative goals of high commitment to the organisation plus high quality and flexibility, then higher worker performance will result" (Guest, 1997, 265). To judge the extent of HRM application, focus will be on the

ORDINARY COURAGE by Joseph Martin Plumb Essay Example | Topics and Well Written Essays - 750 words - 1

ORDINARY COURAGE by Joseph Martin Plumb - Essay Example He wanted to be featured not really as a war time hero but more as an epitome of an ideal soldier upholding the virtues of loyalty, bravery and patriotism. To top it all, he was one of those brought to the harshness of the battlefields at a very young age of 14. (Jones, G., 2009). â€Å"Joseph Plumb Martin was raised by his maternal grandparents in their farm in Connecticut. At the age of 14, he was already in action during the Battles of Lexington and Concord. He managed to get into these battlefields despite the objection from his grandfather. He started his military career when he joined the Continental Regiment that lasted for eight long years (1776-1783)† (Jones, 2009). Peer influence was one of the main reasons why JP Martin joined first the militia, then later enlisted as a private soldier of the Continental Regiment of the Revolutionary army which supported Gen. Washington. â€Å"All of his peers joined the army, forcing him to join too. He was close and loyal to his peers† (Jones, 2009). The other reason why J. P. Martin joined the army was because he got inspired by ‘rage militaire’, a propaganda advocating passion for arms and patriotic fervor (Jones, 2009) and (Glossary). Part of the attractive recruitment package then was the promise to provide continuous ration of food, medicine and clothing and of course, a monthly salary worth $ 6.75 dollars. Like a fever, this enticement swept across the country. (Jones, 2009). JP Martin’s story comes far differently from the rest. Its distinctiveness comes from the â€Å"perspective of a common soldier† (Jones, 2009). During that period, it was not a traditional practi ce for an ordinary person to write about history. Most war write-ups were written from the peripheral standpoint which makes them somewhat superficial as compared to the accounts made by someone like JP Martin who participated in the actual battlefield. One of the major

Creating Value For Customers Marketing Essay

Creating Value For Customers Marketing Essay Marketing has often been defined in terms of satisfying customers needs and wants. Critics however maintain that marketing goes beyond that and creates needs and wants that did not exist before, According to these critics, marketers encourage consumers to spend more money than they should on goods and services they really do not need. Marketing process can be explained as creating value for customers and building customer relationship by doing this the organisation makes profit The various elements of marketing process can be classified as follow Understanding the market place and customers needs and wants. Design a customer driven marketing strategy Construct marketing program that delivers superior value Build profitable relationships and create customer delight Capture value to create profits and customer equity Fig 1 Understanding the market place and customers needs and wants is achieved through in-depth market research and thereby identifying a product gap or needs gap. This will involve trends , how to make things easier , comfortable, better and user friendly. In the early 80s there were few or no mobile phones. A thorough market research has created the need for mobile phones, then came the massive first generation mobile phones. This were later followed by smaller ones and this days we can see the smart phones with in built cameras, time online movies and news ability to actual work from your mobile Samsung note to the new tablets. Every day specialist market research companies, innovators, technicians and scientist all work hand on hand to create a new niche market or brand that makes our lives much more comfortable. Even the pay as you go concept became apparent as people could not continue to pay the incredible high cost then been charged by manufacturers who were looking at ways to cove r the cost of their research and development. So the critics may not be far from the truth but the ideal is marketers coming with ways and products that makes our lives easy. Design a customer driven marketing strategy. Marketing strategy is a long term means of achieving a corporate objective. If we take the example of the mobile phone industry where the likes of Samsung, IPhone, Nokia are in serious competition each as to design a marketing strategy to capture a share of the market. Like a military personnel will define the art of going to warfare. Subhash C. Jain in his book marketing , planning and strategy said within a given environment, marketing strategy deals essential with the interplay of three forces known as the strategic three Cs: the customer, the competition and the corporation. He says marketing strategies focus on ways in which the corporations can differentiate itself from its competitors, capitalizing on its distinctive strengths to deliver better value to its customers. He further concluded that a good marketing strategy should be characterized by (a) clear market definition; a good match between corporate strengths and the needs of the market and (c) superior performance , relative to the competition, in the key success factors of the business.  [1]   Construct marketing program that delivers superior value : This refers to the marketing mix that is the 4ps the Usually referring to E. Jerome McCarthys  [2]  Ã‚  4 P classifications for developing an effective marketing strategy, which encompasses: product, price, placement (distribution) and promotion? When its a consumer-centric marketing mix, it  has been extended to include  three more Ps: people, process and physical evidence, and  three Cs: cost, consumer and competitor. Depending on the industry and the target of the marketing plan, marketing managers will take various approaches to each of the four Ps. The benefits and cost of marketing orientation Market orientation is the understanding of customers requirement and creation of marketing mix which will meet these needs. Market driven means the firms capability to understand, attract and keep valuable customers G. Armstrong and P. Kotler define marketing as social and managing process by which the individuals and groups procure what they need by creating and exchanging values with others.  [3]   A market-oriented company is in a position to achieve competitive advantage thanks to its unique innovative approach to customers. In addition to this, according to the opinion of P. R. Dickson, a competitive advantage should be understood in the sense of dynamics of competition. He expresses disagreement with the standpoint of neoclassic theory of market equilibrium and claims that the main characteristic of the market is its disequilibrium. He sees marketing as a science and skill of creating changes (disequilibrium) in the market in the manner that would provide for the changes that are beneficial for the company. Various responses of salespersons and customers to changes in supply and demand, thinks Dickson, create possibilities that could be used by the company that understands market. He underlines the importance of adjusting company to the market occurrences.  [4]   Benefits and cost of market orientation Figure 2: Customer relationship groups Source: G. Armstrong, P. Kotler, Marketing: An Introduction, 7. ed., Pearson/Prentice-Hall, Upper Saddle River, NJ, 2005, p. 25. The above summaries the benefits and cost of market Orientation other advantages are advantages Responding to Demand Building Customer Value Disadvantages Extensive and Expensive Research and Increasing Value Increases Cost Micro and Macro environmental factors that affect marketing Decision The micro environmental factors are factors that can be controlled by the organisation and relates directly with the business these are considered using the factors in fig 3 Micro Environmental factors Fig 3 Fig 4 shows how different public affects organisation. The public that affect the marketing decision of the yet they can be controlled and are regarded as micro are the relation with the following members of this public eg Financial public this is based on say for example the organisations annual returns. Fig 4 Macro Environmental Factors The Target market for mobile phones companies and IT companies are more likely to be the high income earning spectrum of the society or the new graduates and the city bankers and young people in the top echelon of society who will be able to afford the integrated packages that are about to be launched into the market very soon The package will include home entertainment, office package, security package, phone and video calls and financial/banking package all launched as one integrated hand held device. Market segmentation, and Target is followed by positioning, this should be developed and implemented by creating an image for the product, profiling the target market, High Tech gadgets like this integrated hand held device will be bought based on the technical specification what comfort or ease of doing a task it provide. Buying Behavior is the way and act of people involved in buying and using products. To understand we need to consider why a buyer will make a purchase. what factors influence will influence a buyer to buy a certain product. Buying Behavior refers to how people will behave when buying a certain product. A firm needs to consider and study buying behaviour and peoples reactions to the organisation marketing strategy has this will have great impact on the firms success. The marketing concept show how a marketing mix (MM) that satisfies (gives utility to) customers, hence it important to understand the what, where, when and how consumers buy. Stages of the Consumer Buying Process There are Six Stages to the Consumer Buying Decision Process (For complex decisions). Problem Recognition Information search The evoked set. Evaluation of Alternatives Purchase decision- Post Purchase decision Buying behaviour is often determined by the level of consumer involvement in the purchase decisions, the importance and level of interest the consumer decisions is determined by the motivation to seek information about the product or service. High involvement purchase such as buy a luxury car or other expensive items. Also the element of risk involved in the use of the product that is the social risk and the economic risk. The four type of consumer buying behavior are Routine Response/Programmed Behaviour Limited Decision Making Extensive Decision Making/Complex Impulse buying Routine Response/Programmed Behavior this are low involvement very little or no decision effort is required E.g. A can drink Limited Decision Making This are product bought occasionally example are like clothing but not brands Extensive Decision Making/Complex: This involves unfamiliar, expensive and infrequently bought goods. It involves a high degree of economic performance, and psychological risk. e.g. cars, homes, computers, it also involves a lot of time seeking information and deciding. and consumers will go through all six stages of the buying process. Impulse buying, this are purchase which are unplanned it like buying chewing gum in the conner shop without actually thinking about it. Also prices at time lead to impulse buying. They are usually low valued items. Ethan Lyon,(http://sparxoo.com/2009/06/18/how-to-define-your-market-position/) said The goal of market positioning is to find the ideal opportunity in the market based on customer needs, market forces and financial and strategic considerations. Once the market opportunity is identified then the organisation can further develop its product and elevate its brand to deliver outstanding value. To clarify the market position, the firm will need to find an overarching theme, then define the details. Brand Idea-The idea is an aspirational concept it defines the idea of what the company.For eample the Samsung note goes with the concept of designed for human Value Proposition- A customer or a consumer buyers the Samsung note they see high value and high quality Differentiating Attributes-Samsung has distinguished itself from Apple by targeting the main stream yet providing quality and comparable or better phones than those provided by Apple

Macbeth and its Unbelievable Lady :: Macbeth essays

Macbeth and its Unbelievable Lady      Ã‚  Ã‚  Ã‚   In William Shakespeare's tragedy Macbeth which character is more imaginatively created than that of Lady Macbeth? Can a lady actually think in this manner without being called insane. We examine the various dimensions of her character in this paper.    In Fools of Time: Studies in Shakespearean Tragedy, Northrop Frye shows that Lady Macbeth is the driving force behind her husband, who resolves to "get with it" in the future:    That Macbeth is being hurried into a premature act by his wife is a point unlikely to escape the most listless member of the audience, but Macbeth comes to regret the instant of fatal delay in murdering Macduff, and draws the moral that    The flighty purpose never is o'ertook Unless the deed go with it. From this moment The very firstlings of my heart shall be The firstlings of my hand.    That is, in future he will try to attain the successful ruler's spontaneous rhythm of action. (91)    In his book, On the Design of Shakespearean Tragedy, H. S. Wilson describes the role of Lady Macbeth:    It requires an extraordinary exertion of will and persuasion from Lady Macbeth to strengthen his wavering purpose. Professor Kittredge used to point out to his classes that Lady Macbeth, in urging Macbeth to act, uses the three arguments that every wife, some time or other, uses to every husband: "You promised me you'd do it!" "You'd do it if you loved me!" "If I were a man, I'd do it myself!" But Macbeth's mind is made up by her assurance that they may do it safely by fixing the guilt upon Duncan's chamberlains. (72)    In "Macbeth as the Imitation of an Action" Francis Fergusson specifies the fears within Lady Macbeth:      I do not need to remind you of the great scenes preceding the murder, in which Macbeth and his Lady pull themselves together for their desperate effort. If you think over these scenes, you will notice that the Macbeths understand the action which begins here as a competition and a stunt, against reason and against nature. Lady Macbeth fears her husband's human nature, as well as her own female nature, and therefore she fears the light of reason and the common dayllight world. As for Macbeth, he knows from the first that he is engaged in an irrational stunt: "I have no spur / To prick the sides of my intent, but only / Vaulting ambition, which o'erleaps itself / And falls on the other.

Sostacâ„¢ E-Marketing Plan

What is SOSTACâ„ ¢ ? The SOSTAC Planning System is one of the most powerful planning systems ever developed. Simple but extremely effective, as it contains all the ingredients vital for the perfect marketing plan. Whether a blue chip, like IBM and BT, or small business, professionals who discover SOSTAC Planning System embrace it for life. This method will help you to create, write and develop your marketing plan by breaking down into six elements: Situation analysis, Objectives, Strategy, Tactics, Action and Control. How does it work on B2B company e-marketing plan? 1.Situation analysis Internal audits Current internet marketing audit (business, marketing and internet marketing effectiveness) Audience composition and characteristics Reach of web site, contribution to sales and profitability Suitability of resources to deliver online services in face of competition External audits Marco-economic environment Micro-environment C new marketplace structures, predicted customer activit y Competition C threats from existing rivals, new companies and intermediaries Assess opportunities and threats (SWOT analysis) Markets and product positioningMethods of creation of digital value and detailed statement of customer value poposition 2. Objective analysis corporate objectives of online marketing detailed objective; tangileb and intangible benefits online value promotion 3. Strategy definition investment and commitment to online channels market and product positioning target market strategies C statement of prioritized segments, new segments, online value proposition and differential advantage, significance of non-customer audiences? Change management strategy 4. Tactics Product. Promotion Price Place People 5. Actions SpecifyTasks Resource Partnering and outsourcing Budget including cost for development, promotion and maintenance Staff Implement Risk assessment Legal issues Team organization and responsibilities Development and maintenance process 6. Control Identify a measurement process and metrics covering: Business contribution (channel profitability C revenue, costs, return on investment) Marketing effectiveness (channel outcomes C leads, sales, conversion, rate, channel satisfaction) Online marketing effectiveness (channel behavior C page impressions, visitors, repeat visits, conversion rates)

Accost, Assail, Assault, and Attack

Accost, Assail, Assault, and Attack Accost, Assail, Assault, and Attack Accost, Assail, Assault, and Attack By Maeve Maddox The other day I noticed what I view as a nonstandard use of the verb accost in a news article about a man who â€Å"accosted† his wife when he returned home from prison. Because the woman received bruises in the incident, accost seems to me to be the wrong word. The literal meaning of accost is â€Å"to travel along the coast.† The verb was used to describe the practice of drawing up alongside an enemy coast or ship with the intent to invade or to board. The verb developed the meaning, â€Å"to approach and speak to a person.† An additional connotation implied that the approach was made in â€Å"a hostile or importune manner.† Although assail, from which we get the word assailant, is sometimes offered as a synonym, accost does not usually connote physical contact. Here are typical examples of the use of accost in the sense of hurling verbal abuse: Angry Christian Protester Accosts Katy Perry’s Preacher Dad for Raising a â€Å"Wicked† Daughter Anti-war protester accosts Rice at House hearing Accost is the usual word to describe the approach of a beggar or a prostitute: New Yorkers are used to being  accosted by beggars. He read the law pertaining to soliciting, accosting, or inviting to commit prostitution or an immoral act. The Variety writer responsible for the following headline exhibited a sense of humor by applying the act of accosting to the police: â€Å"Django Unchained’ Actress Says She Was Accosted By Police After Mistaken for Prostitute Accost in the sense of â€Å"to speak to someone in a determined or aggressive manner† is especially frequent in reviews and summaries of the television drama The Good Wife: Alicia accosts Cary and demands to know if he’s â€Å"organizing something.†Ã‚   â€Å"No,† he lies, [saying that] he and the fourth years trust the partners will eventually honor their commitments. Dubeck accosts Peter’s ethics advisor, Marilyn Garbanza, on the street and tries to convince her to cooperate with his election fraud investigation.   Diane accosts Alicia as she exits the elevator in the Lockhart/Gardner lobby. â€Å"Okay. How’d it go?† Both assail and assault can be used to mean â€Å"to make a violent hostile attack by physical means.† In current usage, assault retains this meaning, but assail seems to have become more common in figurative use to describe â€Å"a verbal attack with hostile, opprobrious, or bitter words†: Citizens’ group assails rules targeting farm sales German man whose wife left him assails Kasper proposal in new book Nashville Chief Assails Judge [for] Releasing Man Who Beat His Girlfriend When the act being described is a physical attempt to injure or kill, the most common verb by far is attack: Police were forced to draw their guns this morning after a man attacked two pedestrians with meat cleavers in Sai Ying Pun. Chelsea fans attacked by masked thugs in Kiev A settlement was attacked in the early morning hours. Both assail and assault derive ultimately from a Latin verb meaning â€Å"to spring† or â€Å"to leap.† At one time, assail could mean â€Å"to leap on† or â€Å"to mount,† as in the mating of animals. Shakespeare plays on this meaning of assail, as well as on the earlier, nautical meaning of accost, in the scene in Twelfth Night (1601) in which Sir Toby urges Sir Andrew to offer his attentions to the attractive maid Maria. Sir Andrew, severely vocabulary-challenged, at first thinks that Accost is the woman’s name. When Toby corrects him, Andrew, who apparently does know at least one meaning of the word assail, is mortified: Sir Toby: Accost, Sir Andrew, accost. Sir Andrew: Whats that? Sir Toby: My nieces chambermaid. Sir Andrew: Good Mistress Accost, I desire better acquaintance. Sir Toby: You mistake, knight; accost is ‘front her, board her, woo her, assail her.† Sir Andrew: By my troth, I would not undertake her in this company. Is that the meaning of accost? Use assault or attack when the intended meaning is physical aggression. Save accost to mean approach, confront, or importune. Want to improve your English in five minutes a day? Get a subscription and start receiving our writing tips and exercises daily! Keep learning! Browse the Vocabulary category, check our popular posts, or choose a related post below:Apply to, Apply for, and Apply withPeople versus Persons1,462 Basic Plot Types

Free Essays on There Should Have Been A Warning

Tsunamis are rare in the Indian Ocean, which has no system for detecting then and alerting those in danger. Scientists do not have the equipment to tell when an earthquake has created a tsunami. The first notice of the earthquake that anyone at the Pacific Tsunami Center received was a computer-generated image set off by seismic sensors at 2:59 p.m. on Saturday. Hawaii has warning sirens, and the weather radio network of oceanographic administration to carry tsunami warnings. Any country that has experienced a tsunami recently or that may be hit by one need some kind of warning system to protect their people. Although Sri Lanka is not part of the Pacific tsunami warning system, some officials at the Hawaii station were informed that a tsunami could be developing. The officials then sent a message to Sarath Weerawatnakula, the director of Sri Lanka’s Geological Survey and Mines Bureau. Weerawarnakula said that his organization received an alert from â€Å"international bodies† about the quake. He also stated that it took time to decipher the meaning of the message, and then it was too late to get out a signal. He said that sometimes warnings could be made, but not this time. There is no reason why someone could warn for one tsunami, but not the next one. Even if the signal is late, at least some people will be able to get away. The citizens of Sri Lanka have the right to know that a tsunami is coming; the officials should not hold this information from them. A summit has not decided to create a tsunami early warning system for the Indian Ocean. The high-tech equipment could detect tsunamis that are still miles out at sea. The system works in a simple way. A pressure sensor sits on the bottom of the ocean and measures the weight of the water above it. If a tsunami passes overhead, the pressure increases and the sensor sends a signal to a buoy that is sitting on the sea surface. The buoy then sends a signal to a satellite, which alert... Free Essays on There Should Have Been A Warning Free Essays on There Should Have Been A Warning Tsunamis are rare in the Indian Ocean, which has no system for detecting then and alerting those in danger. Scientists do not have the equipment to tell when an earthquake has created a tsunami. The first notice of the earthquake that anyone at the Pacific Tsunami Center received was a computer-generated image set off by seismic sensors at 2:59 p.m. on Saturday. Hawaii has warning sirens, and the weather radio network of oceanographic administration to carry tsunami warnings. Any country that has experienced a tsunami recently or that may be hit by one need some kind of warning system to protect their people. Although Sri Lanka is not part of the Pacific tsunami warning system, some officials at the Hawaii station were informed that a tsunami could be developing. The officials then sent a message to Sarath Weerawatnakula, the director of Sri Lanka’s Geological Survey and Mines Bureau. Weerawarnakula said that his organization received an alert from â€Å"international bodies† about the quake. He also stated that it took time to decipher the meaning of the message, and then it was too late to get out a signal. He said that sometimes warnings could be made, but not this time. There is no reason why someone could warn for one tsunami, but not the next one. Even if the signal is late, at least some people will be able to get away. The citizens of Sri Lanka have the right to know that a tsunami is coming; the officials should not hold this information from them. A summit has not decided to create a tsunami early warning system for the Indian Ocean. The high-tech equipment could detect tsunamis that are still miles out at sea. The system works in a simple way. A pressure sensor sits on the bottom of the ocean and measures the weight of the water above it. If a tsunami passes overhead, the pressure increases and the sensor sends a signal to a buoy that is sitting on the sea surface. The buoy then sends a signal to a satellite, which alert...

Domtar Research Paper Example | Topics and Well Written Essays - 250 words

Domtar - Research Paper Example Their training would enhance them with skills in the way that they can make efficient strategic goals and how to implement the goals. The employees should be organized according to their levels or ranks in the company. The different groups should be trained differently (Bari, 2000). The learning objectives in Domtar Company would be to cut costs. The costs will be cut if the processes of the company are efficient. The other objective would be to maintain a positive customer relationship. The customers should be considered before the company makes any decision and their satisfaction should be the source of any decision made. The other objective of the training should be to make feasible decisions that will ensure the prosperity of the business. The organizational constraints that may be incurred in the learning process may include; finances. The learning process is an expensive process, hence the cost factor must be considered. The company may not be willing to invest a lot in employee training and that should be avoided. The other constraint may be the time constraint. In the course of the training, the operations of the company must also continue, that means that time available will be minimal. The learning should be organized in a way that the sessions will be accommodated in the normal working schedule of the company. The other constraint that may exist will be resistance from employees. The constraints can be addressed by the employees been told the importance of the training. The other way the constraints can be addressed would be by the company providing resources that are useful in the training.

- Electronic commerce and architecture Research Paper

- Electronic commerce and architecture - Research Paper Example This trend can be attributed to the fact that online shopping is efficient in terms of saving time and an opportunity to virtually draw meaningful comparisons on the various online shops available (Yue, DeSilva, Kim, Aktepe, Nagle, Boerger, Jain & Verma, 2009). Perhaps consumers are attracted by the fact that one can shop anywhere, anytime at leisure and pleasure even in the comfort of pajamas. Consumers have an easy time to search through various databases for goods and services. It is very easy to compare prices at the click of the mouse thus making purchases at best prices possible. Online vendors on the other hand have an easy time to interact with their clients thus a reduced need for intense advertisement. The history of e-commerce from which an interesting timeline can be generated, dates back to the emergence of the notion of selling and buying, computers, modems, cables, electricity and the internet (Slaughter, Levine, Ramesh, Pries-Heje, & Baskerville, 2006). It follows that e-commerce was introduced into the society with the timely emergence of the internet. Surprisingly, e-commerce and its related technology have been there for close to forty years. Today, it is very apparent how thousands of business establishments have continued to embrace websites. This paper seeks to highlight on the history of e-commerce and architecture from the time of its conception followed by its rapid development. Furthermore, the present and the future situation of e-commerce will also be discussed. Yue et al (2009) assert that the original definition of e-commerce was the process of making business transactions electronically from Electronic Fund Transfer (EFT) Electronic Data Interchange (EDI) in relation to the existing technologies. These technologies were first reported in the late 1970’s. They enhanced information exchange and execution of business

McDonalds Cost Structures Assignment Example | Topics and Well Written Essays - 1000 words

McDonalds Cost Structures - Assignment Example The franchises have to pay their own occupancy costs which consist of rent, property taxes, insurance and maintenance costs. Certain corporate general and administrative expenses are fixed too which comprise of office support costs in areas of training, legal, supply chain, finance, information technology and human resources. Variable costs which vary with the level of sales include a major chunk of food and labor costs. Sales staff and countermen whose salaries are based on the number of customers they serve are also variable costs for the company. Also, packaging costs, the paper material, employee benefits, selling and general expenses are variable charges. Certain corporate general costs are variable such as training and restaurant operations. As for the fixed costs, the factors that affect them are mostly the market changes. McDonald's needs to spend more on advertising and promotion when they see that market competition is getting fiercer and bitter. Moreover, in order to retain the higher level experienced staff, they need to raise the salaries of their staff and hence payrolls and compensation of management level employees increase. However, in times of recession like the major financial crisis, all fixed costs also dwindled down. The royalty charges or franchise fee is mainly fixed at a certain percentage after a 25% down payment initially unless the franchisor wants to alter the fixed rate for some reason. The variable costs are more directly responsive to changes in the level of sales. The main factor affecting the variable costs is the demand and the number of sales that McDonald's has. The more people want to eat McDonald's, the higher will be the food supplies costs, the packaging and paper costs, the more the number of counter employees to serve the customers, the higher the selling expenses and other general expenses.

American fast food restaurant Essay Example for Free

American fast food restaurant Essay Subway is an American fast food restaurant franchise that primarily sells submarine sandwiches (subs) and salads. It is owned and operated by Doctors Associates, Inc. Subway is one of the fastest growing franchises in the world with 40,229 restaurants in 102 countries and territories as of 11 September 2013.[1] It is the largest single-brand restaurant chain and the largest restaurant operator globally.[3][4][5] Subways main operations office is in Milford, Connecticut; five regional centers support Subways growing international operations. The regional offices for European franchises are located in Amsterdam, Netherlands; the Australia and New Zealand locations are supported from Brisbane, Australia; the Asian locations are supported from offices located in Beirut, Lebanon, and Singapore; and the Latin America support center is in Miami, Florida. [6] Contents [hide] 1 History 1.1 Early history 2 Products 2.1 Regional variations 2.2 Nutritional content 3 Advertising 3.1 $5 footlongs 3.2 Sub Club 4 Controversies 4.1 Sandwich size 4.2 Franchise relations 4.3 UK VAT treatment 4.4 Caseys trademark case against Subway 5 References 6 External links History Early history Subways original logo used from 1965 to 2002. In 1965, Fred DeLuca borrowed $1,000 from friend Peter Buck to start Petes Super Submarines in Bridgeport, Connecticut, and in the following year they formed Doctors Associates Inc to oversee operations of the restaurants as the franchise expanded.[7] The holding company derives its name from Fred DeLucas goal to earn enough from the business to pay tuition for medical school, as well as Peter Bucks having a doctorate in physics.[8] Doctors Associates is not affiliated with, nor endorsed by, any medical organization.[9] In 1968, the sandwich shop began using the name Subway for the first time.[7] Subway restaurant, Pittsfield Township, Michigan The first Subway on the West Coast was opened in Fresno, California in 1978. [10] The first Subway outside of North America opened in Bahrain, in December 1984.[11]In 2004, Subway began opening stores in Walmart supercenters, and surpassed the number of McDonalds locations inside US Walmart stores in 2007.[12]

Critical Analysis of Oleanna :: essays papers

Critical Analysis of Oleanna The most straight forward gender conflict in the movie Oleanna is that between the Professor and the student. She accuses him of sexual harassment. He denies it and they go before the Tenure Committee who find him guilty. The question at hand is what is sexual harassment? Must the harasser intend to harass? When a student would ask Socrates to answer a question, Socrates would ask them to define their terms. He would continue to ask the student to clarify until finally the student would realize the answer to the question. In this case the question that may have been put to Socrates is "Can a person, man or woman, commit sexual harassment on accident?". The answer from this ugly old man would be "What is sexual harassment?" It is physical advancement, sexist or sexual remarks, even pornographic material, that someone finds offensive and threatening. The Professor in Oleanna sexually harasses the student by this definition. This first part of sexual harassment, that someone must find the activity personally offensive, is met without a doubt. Why? Oleanna says she is offended by his remarks. Only she can know for sure how she feels. The second part of sexual harassment, that the person must be threatened, is harder to prove than for her to just say she was threatened. Oleanna says in her claim that the professor referred to female students as "darlin’" and other such terms of endearment. Why would she feel more threatened than the other women in her class? In defense of the professor it must be understood that he only intended to help Oleanna. He slipped across the line of what is proper behavior. He went from being a teacher to wanting to be a father figure. It is sad but at some point a person must draw a line and realize what they can and cannot accomplish. Another question that pertains to the guilt or innocence of the Professor is a concern for the Bill of Rights.

Morality In “Queen Vs. Dudley And Stephens” Essay

1. In the case of Queen vs. Dudley and Stephens, was the killing of the cabin boy, Richard Parker, morally wrong? Relate your answer to one or more of the following ethical theories: Aristotelian ethics, Hobbesian ethics, Utilitarianism, or Kantian ethics. Be sure to give a summary of the main points of the theory, as well as drawing out its implications for the case. In the case of Dudley and Stephens, the murder of Richard Parker cannot be justified as being morally permissible. Our society functions on certain base principles, one of them being that there are some things which are forbidden, that particular actions or measures can never be correct due to their nature. Murder is an action which qualifies as being fundamentally wrong, it can never be said that murder is the right thing to do, because no matter the context, murder is in no way a morally permissible course of action. While it is true that all of the crew members would most certainly have died if Parker had not been slain, that is still not enough reason to have permitted the murder. Even if the boy had been consulted on the matter and he had subsequently granted his consent, the act of murder still cannot be justified. There is no situation so dire (excluding warfare and self-defense) to warrant the voluntary taking of another human being’s life. Although the crew had already gone numerous days without any form of nourishment, murder was still not the proper course of action. The boy was near death, and perhaps if they had waited just another day he would have died naturally, and then they could have used his body. This standpoint of murder never being the right decision is supported by Aristotle’s theory of â€Å"virtue ethics†. His theory states that we should live our lives according to principles of virtue and morality, and this will lead to an attainment of happiness. Aristotle says that not all of our actions should be virtuous, as an extreme amount of anything won’t bring happiness, but rather we should live to a mean between evil and morality. He believes that through our ability to reason and choose our actions we will reach that mean position and balance our lives to a point of happiness. While the theory does allow us to choose some actions which are not moral

Pride and Prejudice Movie Review Essay

1) In 1859, Charles Darwin described a model of how living things change over time. He described this model and the evidence that supported it in a book called On The Origin of Species. Which scientific term is used to describe a testable model that seeks to explain natural phenomena? A) data B) hypothesis C) observation D) theory 2) When an experiment is repeated and the new results are different from the original results, what could you assume to be true? A) The results from both experiments are worthless. B) The first experiment’s results are worthless and should be discarded. C) The experimental design is flawed and the experiment should be discarded. D) Neither test results are 100% reliable and additional experimentation is needed. 3) All of the following EXCEPT the resistance of _________ demonstrate artificially selected resistance. A) beef cattle, to â€Å"shipping fever†, B) many agricultural wheat varieties, to drought and fungus, C) Anatarctic fish to freezi ng, due to antifreeze proteins in their blood, D) many common grasshopper species to pesticides, such as diazinon, sevin, and others, 4) Which fact about fossils is MOST important to scientists who study evolution? A) Fossils are often found in sedimentary rock. B) Footprints, body structures, and even animal droppings can become fossilized. C) The age of a fossil can be determined by examining the rock strata in which the fossil is found. D) The formation of a fossil depends on the geologic and chemical conditions present when an organism dies. 5) According to the fossil record, five ________________took place, which lowered the variety of species found on Earth today. A) mass clonings B) microevolutions C) mass extinctions D) mass revolutions 6) When an experiment is repeated and the new results are different from the original results, what could you assume to be true? A) The first set of results MUST be incorrect and thrown out. B) The second set of results MUST be inaccurate and thrown out. C) The experimental design must be flawed and should be scrapped. D) The original experiment MAY be inaccurate and further experimentation is needed. 7) If an experiment’s results are accurate, when the experiment is repeated by another scientist, the results A) should be similar to those obtained originally. B) will be identical every time the experiment is repeated. C) should be completely different for a different scientist.

Biography of Mary Sibley, Salem Witch Trials Witness

Biography of Mary Sibley, Salem Witch Trials Witness Mary Sibley (April 21, 1660–ca. 1761) was a key but minor figure in the historical record of the Salem Witch Trials in Massachusetts Colony of 1692. She was the neighbor of the Parris family who advised John Indian to make a witch’s cake. The denouncing of that act has been seen as one of the triggers of the witch craze that followed. Fast Facts: Mary Sibley Known For: Key role in the Salem Witch Trials of 1692Born: April 21, 1660 in Salem, Essex County, MassachusettsParents: Benjamin and Rebecca Canterbury WoodrowDied: c. 1761Education: UnknownSpouse: Samuel Sibley (or Siblehahy or Sibly), February 12, 1656/1257–1708. m. 1686Children: At least 7 Early Life Mary Sibley was a real person, born Mary Woodrow on April 21, 1660 in Salem, in Essex County, Massachusetts. Her parents, Benjamin Woodrow (1635–1697) and Rebecca Canterbury (spelled Catebruy or Cantlebury, 1630–1663), were born in Salem to parents from England. Mary had at least one brother Jospeh/Joseph, born about 1663. Rebecca died when Mary was about 3 years old. Nothing is known of her education, but in 1686, when Mary was about 26 years old, she married Samuel Sibley.  Their first two children were born before 1692, one was born in 1692 (a son, William), and four more were born after the events at Salem, after 1693. Samuel Sibleys Connection to Salem Accusers Mary Sibleys husband had a sister Mary, who was married to Captain Jonathan Walcott or  Wolcott, and their daughter was Mary Wolcott. Mary Wolcott became one of the accusers of witches in the Salem community in May 1692 when she was about 17 years old. Those she accused included  Ann Foster. Mary Wolcott’s father John had remarried after Samuels sister Mary died, and Mary Wolcotts new stepmother was Deliverance Putnam Wolcott, a sister of Thomas Putnam, Jr.  Thomas Putnam Jr. was  one of the accusers at Salem as were his wife and daughter, Ann Putnam, Sr. and Ann Putnam, Jr. Salem 1692 In January of 1692, two girls in the home of the Rev. Samuel Parris, Elizabeth (Betty) Parris  and  Abigail Williams, ages 9 and 12,  began exhibiting very strange symptoms, and a  Caribbean slave, Tituba, also experienced images of the devil- all according to later testimony.  A doctor diagnosed the â€Å"Evil Hand† as the cause, and Mary Sibley offered the idea of the witch’s cake to John Indian, a Caribbean slave of the Parris family. The primary evidence in the trial against the group was the witchs cake, a common folk magic tool made using the urine of the afflicted girls. Supposedly, sympathetic magic meant that the evil afflicting them would be in the cake, and, when a dog consumed the cake, it would point to the witches who had afflicted them.  While this was apparently a known practice in English folk culture to identify likely witches, the Rev. Parris in his Sunday sermon denounced even such well-intentioned  uses of magic, as they could also be â€Å"diabolical† (works of the devil). The witchs cake didnt stop the afflictions of the two girls.  Instead, two additional girls began to show some afflictions:  Ann Putnam Jr.,  connected to Mary Sibley through her husbands brother-in-law, and Elizabeth Hubbard. Confession and Restoration Mary Sibley confessed in church that she had erred, and the congregation acknowledged their satisfaction with her confession by a show of hands. She probably thereby avoided being accused as a witch. The next month, the town records note her suspension from communion and restoration to full congregational inclusion when she made her confession. March 11, 1692 – Mary, the wife of Samuel Sibley, having been suspended from communion with the church there, for the advices she gave John [husband of Tituba] to make the above experiment, is restored on confession that her purpose was innocent. Neither Mary nor Samuel Sibley appears on the 1689 register of covenanted church members of the Salem Village church, so they must have joined after that date. According to genealogical records, she lived well into her nineties, dying about 1761. Fictional Representations In the 2014 Salem-based supernatural scripted series  from WGN America, Salem,  Janet Montgomery stared as Mary Sibley, who in this fictional representation is an actual witch. She is, in the fictional universe, the most powerful witch in Salem.  Her maiden name is Mary Walcott, similar but not the same as the maiden name, Woodrow, of the real-life Mary Sibley. Another Mary Walcott in the real Salem universe was one of the key accusers at age 17, a niece of Ann Putnam Sr. and cousin of Ann Putnam Jr. That Mary Walcott (or Wolcott) in the real Salem was a niece of Samuel Sibley, husband of the Mary Sibley who baked the witchs cake.  The producers of the  Salem  series seem to have combined the characters of Mary Walcott and Mary Sibley, niece, and aunt, to create a completely fictionalized character. In the pilot of the series, the fictional Mary Sibley assists her husband in throwing up a frog. In this version of the Salem witch history, Mary Sibley is married to George Sibley and is a former lover of John Alden (who is much younger in the show than he was in the real Salem.) The Salem  show even introduced a character, Countess Marburg, a German witch  and terrible villain who has had an unnaturally long life.  At the end of Season 2, Tituba and the Countess die, but Mary goes on for another season. Ultimately, Mary comes to wholeheartedly regret her choices. She and her lover are reconciled and fight for the future together. Sources Ancestry.com.  Massachusetts, Town and Vital Records, 1620-1988  [database on-line]. Provo, UT, USA: Ancestry.com Operations, Inc., 2011.  Original data:  Town and City Clerks of Massachusetts.  Massachusetts Vital and Town Records. Provo, UT: Holbrook Research Institute (Jay and Delene Holbrook).  Note that the image clearly shows 1660 as the birth date, though the text at the site interprets it as 1666.Mary Sibley. Geni, January 22, 2019.Yates Publishing.  U.S. and International Marriage Records, 1560-1900  [database on-line]. Provo, UT, USA: Ancestry.com Operations Inc, 2004.Jalalzai, Zubeda. Historical Fiction and Maryse Condà ©s I, Tituba, Black Witch of Salem. African American Review 43.2/3 (2009): 413–25.Latner, Richard. Here Are No Newters: Witchcraft and Religious Discord in Salem Village and Andover. The New England Quarterly 79.1 (2006): 92–122.Ray, Benjamin C. The Salem Witch Mania: Recent Scholarship and American History Textbooks. Journal of the American Academy of Religion 78.1 (2010): 40–64. Satans War against the Covenant in Salem Village, 1692. The New England Quarterly 80.1 (2007): 69–95.

Basic Facts about a Starfishs Biology and Behavior

Basic Facts about a Starfish's Biology and Behavior Starfish are star-shaped invertebrates that can be a variety of shapes, sizes, and colors. You might be most familiar with starfish that live in tide pools in the intertidal zone, but some live in deep water. Classification Kingdom: AnimaliaPhylum: EchinodermataClass: Asteroidea Background Even though they are commonly called starfish, these animals are known more scientifically as sea stars. They do not have gills, fins, or even a skeleton. Sea stars have a tough, spiny covering and a soft underside. If you turn over a live sea star, youll likely see its hundreds of tube feet wiggling. There are over 2,000 species of sea stars, and they come in all sizes, shapes, and colors. Their most noticeable characteristic is their arms. Many sea star species have five arms, but some, like the sun star, can have up to 40. Distribution Sea stars live in all the worlds oceans. They can be found in tropical to polar habitats, and from deep to shallow water. Visit a local tide pool, and you may be lucky enough to find a sea star! Reproduction Sea stars may reproduce sexually or asexually. There are male and female sea stars, but they are indistinguishable from one another. They reproduce by releasing sperm or eggs into the water, which, once fertilized, become free-swimming larvae that later settle to the ocean bottom. Sea stars reproduce asexually by regeneration. A sea star can regenerate an arm  and nearly its entire body if at least a portion of the sea stars central disc remains. Sea Star Vascular System Sea stars move using their tube feet and have an advanced water vascular system that they use to fill up their feet with sea water. They do not have blood but instead take in seawater through the sieve plate, or madreporite, located on top of the sea star, and use that to fill up their feet. They can retract their feet using muscles or use them as suction to hold onto a substrate or its prey. Sea Star Feeding Sea stars feed on bivalves like clams and mussels, and other animals such as small fish, barnacles, oysters, snails, and limpets. They feed by grasping their prey with their arms and extruding their stomach through their mouth and outside their body, where they digest the prey. They then slide their stomach back into their body.

6 Myths and Fallacies About College Admissions

6 Myths and Fallacies About College Admissions The college admissions process is competitive and frenzied enough without falling prey to its most insidious myths. Believing any of these lies adds anxiety to an already stressful process, says Josh Bottomly, a college admissions expert and associate director of college counseling at the Casady School, a private prep school in Oklahoma City. And it could actually result in your child being rejected by some or all of his top choice schools. Myth #1: Only Top Tier Schools Prepare People for Success The most pervasive myth in our culture is that only certain schools (aka Ivies) will prepare people for success, says Bottomly. The underlying idea is that if a student doesn’t graduate from a Top 20 Newsweek-rated college, then they won’t have opportunities for jobs, promotions, and influence. Well, tell that to over half of our U.S. Senators. They graduated from public universities. Tell that to 43 of the top 50 CEO’s in the world. They graduated from schools other than Ivies. Tell that to Condoleezza Rice – a graduate of the University of Denver. Or Steven Spielberg. He was rejected from USC three times. He graduated from Cal State Long Beach. Or Tom Hanks. He attended Chabot Community College. Part of the genius of America is that you can make your destiny by what you do, not where you go to college. Myth #2: A College Brochure in the Mailbox Means Something Too often, says Bottomly, parents and students will fall victim to college attract to reject marketing campaigns. Through a flurry of glossy brochures and enticing paraphernalia, colleges will dupe students into believing an acceptance letter ensues. The truth is, the college only wants the application. The more applications a college receives, the more it can reject. The more it rejects, the higher its ranking goes up. And let’s be honest: college rankings are to Newsweek what the swimsuit issue is to Sports Illustrated. Sex sells. So do rankings. Myth #3: Applying to More Schools Increases Ones Chances Sometimes, says Bottomly, I will run into a parent who thinks he or she has done the math: If my student applies to more selective schools, it will increase his chances of getting into one of them. My response: Imagine you’re an archer. The target stands 1000 feet away. The bull’s eye is the size of a pea. According to Bill Fitzsimmons, dean of admissions at Harvard, that’s your odds at getting into a Top 20 University – about 3% without an admissions advantage. The fallacy here is to think that if you apply to all 20 schools that you will broaden the bull’s eye. Fitzsimmons response: All a student has done is drawn a circle around the same pea-size target 20 times. My advice then: shorten the distance to the target and broaden the bull’s eye. The former means, you apply to more schools where your GPA and test scores (ACT or SAT) fall into the median range. The latter means you apply to at least six first choice schools where you are competit ive. By doing this, you will significantly increase your chances of hitting your target. Myth #4: Once you send in the application, youre done.Myth #5: Large universities offer more opportunities than small liberal arts colleges.Myth #6: Colleges are looking for well-rounded students.

Petro-Canada's Total Compensation Strategy and Program Research Paper - 3

Petro-Canada's Total Compensation Strategy and Program - Research Paper Example This paper illustrates that Petro-Canada is a public organization producing oil and gas organization and taking part in all of the upstream and downstream operations. The company is known for exploring for and producing energy not only locally but also internationally. It has as many as 1,323 retail outlets which supply petroleum products and services across the nation. Headquarter of the company is located at the in downtown Calgary in Alberta. In the year 2008, the total revenue of the company was $27,785,000, while its employee strength was 6,088. The oil and gas industry in Canada happens to be highly competitive having strong competitors like Encana etc. The objective to increase strength and emerge as a larger oil and gas company the company decided to merge with Suncor in the year 2009. However, now it operates as a subsidiary of the parent company, Suncor Energy. The cash compensation received by an Applications analyst I in Petro-Canada is CDN$75,000-85,000 (Tang, 2010). Thi s is a much higher amount as compared to the average market rate which is $50,795. Thus it can be said that the company has a lead policy in this regard. Apart from having an attractive salary the company also has a scheme of sharing profits with employees which happens at the end of each fiscal year. The amount of the profits shared with the workers depends on the performance of the company at that financial year. As per the rules of the company an Application Analyst I is able to earn an amount of 10% of his base pay as profit sharing. In this way, an employee could earn as high as 15% to 20% when the company has a successful performance in a year.

Business Law Ethics - Utilitarianism, Kantian and Virtue Ethics Case Study

Business Law Ethics - Utilitarianism, Kantian and Virtue Ethics - Case Study Example The waiters are university students who need to pay their university bills; Mike the chef is the sole breadwinner of his family who fends for his young family. (Hoffman, Frederick & Schwartz, 2014). If the business is closed due to its bad hygiene, the customers may shun from the restaurant even after being reopened. The loyal customers might feel cheated and disappointed due to the unhygienic food they have frequently been served (Hoffman, Frederick & Schwartz, 2014). The closure of the business will affect the surrounding community due to its bad reputation. The community provides the business with labour and other social values like goodwill, which when broken would be so hard to replace (Hoffman, Frederick & Schwartz, 2014). By the restaurant being closed, the local government may lose its periodical levies due to lack of operation of the restaurant. The government depends on fiscal policies like taxes to implement its strategic and short-term objectives (Hoffman, Frederick & Schwartz, 2014). Ted should remit the $500 bribe in order to maintain the happiness of his key stakeholders to avoid future problems. The stakeholders would greatly suffer socially and financially in case Ted refuses to part with the amount. (Hoffman, Frederick & Schwartz, 2014). In Kant theory, actions should be governed by the accepted principles of Maxims. Universal acceptability will not conform to Ted’s issuance of the bribe due to its negative perception globally. In terms of respect, Ted respects the well being of his employees and that’s he should pay to safeguard their future (Brenkert & Beauchamp, 2010). When formulating a maxim against bribery and later testing it against the categorical imperative, two results are realized. The first maxim fails in Universal acceptability because bribery is an economic crime worldwide. The second maxim against respect conforms to the categorical imperative; this is due to Ted’s respect to his key stakeholders.  Ã‚  

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Information Technology Analysis Term Paper Example | Topics and Well Written Essays - 1000 words

Information Technology Analysis - Term Paper Example According to Information Systems Audit and Control Association (ISACA) the five major components of IM / IT governance are:strategic alignment, value delivery, resource management, risk management and performance measurement (ISACA, 2009). Strategic alignment: In a health care organization,suppose a hospital, strategic alignment is when the corporate business goals of the hospital and its departmental or functional goals are aligned with each other. More specifically to achieve strategic alignment, what the top management has to work upon is making a set of attainable goals and objectives and communicate them to all the subordinate department heads so that the narrowed down departmental operational goals are aligned with the more broader corporate ones. As a result when IT operations help to achieve the hospital’s overall desired strategic goals, whether they are providing best quality healthcare services to patients, maintaining healthy hospital environment, providing fast an d efficient healthcare services, etc., the health care quality to the end customer (patients) will be improved. Value delivery: Values are the organization’s fundamental underlying aims and goals based on which the IT strategies, policies and plans are structured so that best possible decisions can be made to guide operations. IT governance delivers maximum value and improves healthcare quality when while making an IT based decision, the alternative with higher value is chosen. For example, one decision might increase customer satisfaction; the second alternative decision might increase hospital’s revenue while the third might increase both. Logically, the third alternative should be opted for, so quality is improved with best value delivery. Value delivery is contingent to management’s decision making. Resource management: It is quite obvious that IT departments or projects require a reasonable amount of resource investment including human resources, capital, t ime, space, etc. IT governance involves managing resources and making intelligent decisions so that the quality of health care is improved with optimum resource allocation i.e. getting maximum value from resources allocated at lowest cost so that healthcare is improved (Weill & Olson, 1989). Risk management: Risk in IT governance has three levels: innovation, agile execution and cost efficiency (Mueller et al, 2008). For an IT decision to be at its least risk so that healthcare is improved the most effective level is cost efficiency because on the scale of risk versus time elapsed, cost efficiency is when the IT decision bears least risk as compared to the other two levels. Although, it is to be noted that for every new IT project in any healthcare organization the risk level is highest if the idea is supposed to bring a strikingly abrupt change initiative. For example: shiftinga hospital’s completely manual patient-file-system to an enterprise databasewill drastically improv e healthcare quality but will have high risk involved. Again, it is the management’s decision that evaluates value versus feasibility. The best decision is then, the one that maximizes value and improves healthcare quality minimizing risk to the least. Performance measurement: IT governance improves quality of healthcare when appropriate performance measures are used to evaluate whether the