McDonalds Cost Structures Assignment Example | Topics and Well Written Essays - 1000 words

McDonalds Cost Structures - Assignment Example The franchises have to pay their own occupancy costs which consist of rent, property taxes, insurance and maintenance costs. Certain corporate general and administrative expenses are fixed too which comprise of office support costs in areas of training, legal, supply chain, finance, information technology and human resources. Variable costs which vary with the level of sales include a major chunk of food and labor costs. Sales staff and countermen whose salaries are based on the number of customers they serve are also variable costs for the company. Also, packaging costs, the paper material, employee benefits, selling and general expenses are variable charges. Certain corporate general costs are variable such as training and restaurant operations. As for the fixed costs, the factors that affect them are mostly the market changes. McDonald's needs to spend more on advertising and promotion when they see that market competition is getting fiercer and bitter. Moreover, in order to retain the higher level experienced staff, they need to raise the salaries of their staff and hence payrolls and compensation of management level employees increase. However, in times of recession like the major financial crisis, all fixed costs also dwindled down. The royalty charges or franchise fee is mainly fixed at a certain percentage after a 25% down payment initially unless the franchisor wants to alter the fixed rate for some reason. The variable costs are more directly responsive to changes in the level of sales. The main factor affecting the variable costs is the demand and the number of sales that McDonald's has. The more people want to eat McDonald's, the higher will be the food supplies costs, the packaging and paper costs, the more the number of counter employees to serve the customers, the higher the selling expenses and other general expenses.

American fast food restaurant Essay Example for Free

American fast food restaurant Essay Subway is an American fast food restaurant franchise that primarily sells submarine sandwiches (subs) and salads. It is owned and operated by Doctors Associates, Inc. Subway is one of the fastest growing franchises in the world with 40,229 restaurants in 102 countries and territories as of 11 September 2013.[1] It is the largest single-brand restaurant chain and the largest restaurant operator globally.[3][4][5] Subways main operations office is in Milford, Connecticut; five regional centers support Subways growing international operations. The regional offices for European franchises are located in Amsterdam, Netherlands; the Australia and New Zealand locations are supported from Brisbane, Australia; the Asian locations are supported from offices located in Beirut, Lebanon, and Singapore; and the Latin America support center is in Miami, Florida. [6] Contents [hide] 1 History 1.1 Early history 2 Products 2.1 Regional variations 2.2 Nutritional content 3 Advertising 3.1 $5 footlongs 3.2 Sub Club 4 Controversies 4.1 Sandwich size 4.2 Franchise relations 4.3 UK VAT treatment 4.4 Caseys trademark case against Subway 5 References 6 External links History Early history Subways original logo used from 1965 to 2002. In 1965, Fred DeLuca borrowed $1,000 from friend Peter Buck to start Petes Super Submarines in Bridgeport, Connecticut, and in the following year they formed Doctors Associates Inc to oversee operations of the restaurants as the franchise expanded.[7] The holding company derives its name from Fred DeLucas goal to earn enough from the business to pay tuition for medical school, as well as Peter Bucks having a doctorate in physics.[8] Doctors Associates is not affiliated with, nor endorsed by, any medical organization.[9] In 1968, the sandwich shop began using the name Subway for the first time.[7] Subway restaurant, Pittsfield Township, Michigan The first Subway on the West Coast was opened in Fresno, California in 1978. [10] The first Subway outside of North America opened in Bahrain, in December 1984.[11]In 2004, Subway began opening stores in Walmart supercenters, and surpassed the number of McDonalds locations inside US Walmart stores in 2007.[12]

Critical Analysis of Oleanna :: essays papers

Critical Analysis of Oleanna The most straight forward gender conflict in the movie Oleanna is that between the Professor and the student. She accuses him of sexual harassment. He denies it and they go before the Tenure Committee who find him guilty. The question at hand is what is sexual harassment? Must the harasser intend to harass? When a student would ask Socrates to answer a question, Socrates would ask them to define their terms. He would continue to ask the student to clarify until finally the student would realize the answer to the question. In this case the question that may have been put to Socrates is "Can a person, man or woman, commit sexual harassment on accident?". The answer from this ugly old man would be "What is sexual harassment?" It is physical advancement, sexist or sexual remarks, even pornographic material, that someone finds offensive and threatening. The Professor in Oleanna sexually harasses the student by this definition. This first part of sexual harassment, that someone must find the activity personally offensive, is met without a doubt. Why? Oleanna says she is offended by his remarks. Only she can know for sure how she feels. The second part of sexual harassment, that the person must be threatened, is harder to prove than for her to just say she was threatened. Oleanna says in her claim that the professor referred to female students as "darlin’" and other such terms of endearment. Why would she feel more threatened than the other women in her class? In defense of the professor it must be understood that he only intended to help Oleanna. He slipped across the line of what is proper behavior. He went from being a teacher to wanting to be a father figure. It is sad but at some point a person must draw a line and realize what they can and cannot accomplish. Another question that pertains to the guilt or innocence of the Professor is a concern for the Bill of Rights.

Morality In “Queen Vs. Dudley And Stephens” Essay

1. In the case of Queen vs. Dudley and Stephens, was the killing of the cabin boy, Richard Parker, morally wrong? Relate your answer to one or more of the following ethical theories: Aristotelian ethics, Hobbesian ethics, Utilitarianism, or Kantian ethics. Be sure to give a summary of the main points of the theory, as well as drawing out its implications for the case. In the case of Dudley and Stephens, the murder of Richard Parker cannot be justified as being morally permissible. Our society functions on certain base principles, one of them being that there are some things which are forbidden, that particular actions or measures can never be correct due to their nature. Murder is an action which qualifies as being fundamentally wrong, it can never be said that murder is the right thing to do, because no matter the context, murder is in no way a morally permissible course of action. While it is true that all of the crew members would most certainly have died if Parker had not been slain, that is still not enough reason to have permitted the murder. Even if the boy had been consulted on the matter and he had subsequently granted his consent, the act of murder still cannot be justified. There is no situation so dire (excluding warfare and self-defense) to warrant the voluntary taking of another human being’s life. Although the crew had already gone numerous days without any form of nourishment, murder was still not the proper course of action. The boy was near death, and perhaps if they had waited just another day he would have died naturally, and then they could have used his body. This standpoint of murder never being the right decision is supported by Aristotle’s theory of â€Å"virtue ethics†. His theory states that we should live our lives according to principles of virtue and morality, and this will lead to an attainment of happiness. Aristotle says that not all of our actions should be virtuous, as an extreme amount of anything won’t bring happiness, but rather we should live to a mean between evil and morality. He believes that through our ability to reason and choose our actions we will reach that mean position and balance our lives to a point of happiness. While the theory does allow us to choose some actions which are not moral

Pride and Prejudice Movie Review Essay

1) In 1859, Charles Darwin described a model of how living things change over time. He described this model and the evidence that supported it in a book called On The Origin of Species. Which scientific term is used to describe a testable model that seeks to explain natural phenomena? A) data B) hypothesis C) observation D) theory 2) When an experiment is repeated and the new results are different from the original results, what could you assume to be true? A) The results from both experiments are worthless. B) The first experiment’s results are worthless and should be discarded. C) The experimental design is flawed and the experiment should be discarded. D) Neither test results are 100% reliable and additional experimentation is needed. 3) All of the following EXCEPT the resistance of _________ demonstrate artificially selected resistance. A) beef cattle, to â€Å"shipping fever†, B) many agricultural wheat varieties, to drought and fungus, C) Anatarctic fish to freezi ng, due to antifreeze proteins in their blood, D) many common grasshopper species to pesticides, such as diazinon, sevin, and others, 4) Which fact about fossils is MOST important to scientists who study evolution? A) Fossils are often found in sedimentary rock. B) Footprints, body structures, and even animal droppings can become fossilized. C) The age of a fossil can be determined by examining the rock strata in which the fossil is found. D) The formation of a fossil depends on the geologic and chemical conditions present when an organism dies. 5) According to the fossil record, five ________________took place, which lowered the variety of species found on Earth today. A) mass clonings B) microevolutions C) mass extinctions D) mass revolutions 6) When an experiment is repeated and the new results are different from the original results, what could you assume to be true? A) The first set of results MUST be incorrect and thrown out. B) The second set of results MUST be inaccurate and thrown out. C) The experimental design must be flawed and should be scrapped. D) The original experiment MAY be inaccurate and further experimentation is needed. 7) If an experiment’s results are accurate, when the experiment is repeated by another scientist, the results A) should be similar to those obtained originally. B) will be identical every time the experiment is repeated. C) should be completely different for a different scientist.

Biography of Mary Sibley, Salem Witch Trials Witness

Biography of Mary Sibley, Salem Witch Trials Witness Mary Sibley (April 21, 1660–ca. 1761) was a key but minor figure in the historical record of the Salem Witch Trials in Massachusetts Colony of 1692. She was the neighbor of the Parris family who advised John Indian to make a witch’s cake. The denouncing of that act has been seen as one of the triggers of the witch craze that followed. Fast Facts: Mary Sibley Known For: Key role in the Salem Witch Trials of 1692Born: April 21, 1660 in Salem, Essex County, MassachusettsParents: Benjamin and Rebecca Canterbury WoodrowDied: c. 1761Education: UnknownSpouse: Samuel Sibley (or Siblehahy or Sibly), February 12, 1656/1257–1708. m. 1686Children: At least 7 Early Life Mary Sibley was a real person, born Mary Woodrow on April 21, 1660 in Salem, in Essex County, Massachusetts. Her parents, Benjamin Woodrow (1635–1697) and Rebecca Canterbury (spelled Catebruy or Cantlebury, 1630–1663), were born in Salem to parents from England. Mary had at least one brother Jospeh/Joseph, born about 1663. Rebecca died when Mary was about 3 years old. Nothing is known of her education, but in 1686, when Mary was about 26 years old, she married Samuel Sibley.  Their first two children were born before 1692, one was born in 1692 (a son, William), and four more were born after the events at Salem, after 1693. Samuel Sibleys Connection to Salem Accusers Mary Sibleys husband had a sister Mary, who was married to Captain Jonathan Walcott or  Wolcott, and their daughter was Mary Wolcott. Mary Wolcott became one of the accusers of witches in the Salem community in May 1692 when she was about 17 years old. Those she accused included  Ann Foster. Mary Wolcott’s father John had remarried after Samuels sister Mary died, and Mary Wolcotts new stepmother was Deliverance Putnam Wolcott, a sister of Thomas Putnam, Jr.  Thomas Putnam Jr. was  one of the accusers at Salem as were his wife and daughter, Ann Putnam, Sr. and Ann Putnam, Jr. Salem 1692 In January of 1692, two girls in the home of the Rev. Samuel Parris, Elizabeth (Betty) Parris  and  Abigail Williams, ages 9 and 12,  began exhibiting very strange symptoms, and a  Caribbean slave, Tituba, also experienced images of the devil- all according to later testimony.  A doctor diagnosed the â€Å"Evil Hand† as the cause, and Mary Sibley offered the idea of the witch’s cake to John Indian, a Caribbean slave of the Parris family. The primary evidence in the trial against the group was the witchs cake, a common folk magic tool made using the urine of the afflicted girls. Supposedly, sympathetic magic meant that the evil afflicting them would be in the cake, and, when a dog consumed the cake, it would point to the witches who had afflicted them.  While this was apparently a known practice in English folk culture to identify likely witches, the Rev. Parris in his Sunday sermon denounced even such well-intentioned  uses of magic, as they could also be â€Å"diabolical† (works of the devil). The witchs cake didnt stop the afflictions of the two girls.  Instead, two additional girls began to show some afflictions:  Ann Putnam Jr.,  connected to Mary Sibley through her husbands brother-in-law, and Elizabeth Hubbard. Confession and Restoration Mary Sibley confessed in church that she had erred, and the congregation acknowledged their satisfaction with her confession by a show of hands. She probably thereby avoided being accused as a witch. The next month, the town records note her suspension from communion and restoration to full congregational inclusion when she made her confession. March 11, 1692 – Mary, the wife of Samuel Sibley, having been suspended from communion with the church there, for the advices she gave John [husband of Tituba] to make the above experiment, is restored on confession that her purpose was innocent. Neither Mary nor Samuel Sibley appears on the 1689 register of covenanted church members of the Salem Village church, so they must have joined after that date. According to genealogical records, she lived well into her nineties, dying about 1761. Fictional Representations In the 2014 Salem-based supernatural scripted series  from WGN America, Salem,  Janet Montgomery stared as Mary Sibley, who in this fictional representation is an actual witch. She is, in the fictional universe, the most powerful witch in Salem.  Her maiden name is Mary Walcott, similar but not the same as the maiden name, Woodrow, of the real-life Mary Sibley. Another Mary Walcott in the real Salem universe was one of the key accusers at age 17, a niece of Ann Putnam Sr. and cousin of Ann Putnam Jr. That Mary Walcott (or Wolcott) in the real Salem was a niece of Samuel Sibley, husband of the Mary Sibley who baked the witchs cake.  The producers of the  Salem  series seem to have combined the characters of Mary Walcott and Mary Sibley, niece, and aunt, to create a completely fictionalized character. In the pilot of the series, the fictional Mary Sibley assists her husband in throwing up a frog. In this version of the Salem witch history, Mary Sibley is married to George Sibley and is a former lover of John Alden (who is much younger in the show than he was in the real Salem.) The Salem  show even introduced a character, Countess Marburg, a German witch  and terrible villain who has had an unnaturally long life.  At the end of Season 2, Tituba and the Countess die, but Mary goes on for another season. Ultimately, Mary comes to wholeheartedly regret her choices. She and her lover are reconciled and fight for the future together. Sources Ancestry.com.  Massachusetts, Town and Vital Records, 1620-1988  [database on-line]. Provo, UT, USA: Ancestry.com Operations, Inc., 2011.  Original data:  Town and City Clerks of Massachusetts.  Massachusetts Vital and Town Records. Provo, UT: Holbrook Research Institute (Jay and Delene Holbrook).  Note that the image clearly shows 1660 as the birth date, though the text at the site interprets it as 1666.Mary Sibley. Geni, January 22, 2019.Yates Publishing.  U.S. and International Marriage Records, 1560-1900  [database on-line]. Provo, UT, USA: Ancestry.com Operations Inc, 2004.Jalalzai, Zubeda. Historical Fiction and Maryse Condà ©s I, Tituba, Black Witch of Salem. African American Review 43.2/3 (2009): 413–25.Latner, Richard. Here Are No Newters: Witchcraft and Religious Discord in Salem Village and Andover. The New England Quarterly 79.1 (2006): 92–122.Ray, Benjamin C. The Salem Witch Mania: Recent Scholarship and American History Textbooks. Journal of the American Academy of Religion 78.1 (2010): 40–64. Satans War against the Covenant in Salem Village, 1692. The New England Quarterly 80.1 (2007): 69–95.

Basic Facts about a Starfishs Biology and Behavior

Basic Facts about a Starfish's Biology and Behavior Starfish are star-shaped invertebrates that can be a variety of shapes, sizes, and colors. You might be most familiar with starfish that live in tide pools in the intertidal zone, but some live in deep water. Classification Kingdom: AnimaliaPhylum: EchinodermataClass: Asteroidea Background Even though they are commonly called starfish, these animals are known more scientifically as sea stars. They do not have gills, fins, or even a skeleton. Sea stars have a tough, spiny covering and a soft underside. If you turn over a live sea star, youll likely see its hundreds of tube feet wiggling. There are over 2,000 species of sea stars, and they come in all sizes, shapes, and colors. Their most noticeable characteristic is their arms. Many sea star species have five arms, but some, like the sun star, can have up to 40. Distribution Sea stars live in all the worlds oceans. They can be found in tropical to polar habitats, and from deep to shallow water. Visit a local tide pool, and you may be lucky enough to find a sea star! Reproduction Sea stars may reproduce sexually or asexually. There are male and female sea stars, but they are indistinguishable from one another. They reproduce by releasing sperm or eggs into the water, which, once fertilized, become free-swimming larvae that later settle to the ocean bottom. Sea stars reproduce asexually by regeneration. A sea star can regenerate an arm  and nearly its entire body if at least a portion of the sea stars central disc remains. Sea Star Vascular System Sea stars move using their tube feet and have an advanced water vascular system that they use to fill up their feet with sea water. They do not have blood but instead take in seawater through the sieve plate, or madreporite, located on top of the sea star, and use that to fill up their feet. They can retract their feet using muscles or use them as suction to hold onto a substrate or its prey. Sea Star Feeding Sea stars feed on bivalves like clams and mussels, and other animals such as small fish, barnacles, oysters, snails, and limpets. They feed by grasping their prey with their arms and extruding their stomach through their mouth and outside their body, where they digest the prey. They then slide their stomach back into their body.

6 Myths and Fallacies About College Admissions

6 Myths and Fallacies About College Admissions The college admissions process is competitive and frenzied enough without falling prey to its most insidious myths. Believing any of these lies adds anxiety to an already stressful process, says Josh Bottomly, a college admissions expert and associate director of college counseling at the Casady School, a private prep school in Oklahoma City. And it could actually result in your child being rejected by some or all of his top choice schools. Myth #1: Only Top Tier Schools Prepare People for Success The most pervasive myth in our culture is that only certain schools (aka Ivies) will prepare people for success, says Bottomly. The underlying idea is that if a student doesn’t graduate from a Top 20 Newsweek-rated college, then they won’t have opportunities for jobs, promotions, and influence. Well, tell that to over half of our U.S. Senators. They graduated from public universities. Tell that to 43 of the top 50 CEO’s in the world. They graduated from schools other than Ivies. Tell that to Condoleezza Rice – a graduate of the University of Denver. Or Steven Spielberg. He was rejected from USC three times. He graduated from Cal State Long Beach. Or Tom Hanks. He attended Chabot Community College. Part of the genius of America is that you can make your destiny by what you do, not where you go to college. Myth #2: A College Brochure in the Mailbox Means Something Too often, says Bottomly, parents and students will fall victim to college attract to reject marketing campaigns. Through a flurry of glossy brochures and enticing paraphernalia, colleges will dupe students into believing an acceptance letter ensues. The truth is, the college only wants the application. The more applications a college receives, the more it can reject. The more it rejects, the higher its ranking goes up. And let’s be honest: college rankings are to Newsweek what the swimsuit issue is to Sports Illustrated. Sex sells. So do rankings. Myth #3: Applying to More Schools Increases Ones Chances Sometimes, says Bottomly, I will run into a parent who thinks he or she has done the math: If my student applies to more selective schools, it will increase his chances of getting into one of them. My response: Imagine you’re an archer. The target stands 1000 feet away. The bull’s eye is the size of a pea. According to Bill Fitzsimmons, dean of admissions at Harvard, that’s your odds at getting into a Top 20 University – about 3% without an admissions advantage. The fallacy here is to think that if you apply to all 20 schools that you will broaden the bull’s eye. Fitzsimmons response: All a student has done is drawn a circle around the same pea-size target 20 times. My advice then: shorten the distance to the target and broaden the bull’s eye. The former means, you apply to more schools where your GPA and test scores (ACT or SAT) fall into the median range. The latter means you apply to at least six first choice schools where you are competit ive. By doing this, you will significantly increase your chances of hitting your target. Myth #4: Once you send in the application, youre done.Myth #5: Large universities offer more opportunities than small liberal arts colleges.Myth #6: Colleges are looking for well-rounded students.

Petro-Canada's Total Compensation Strategy and Program Research Paper - 3

Petro-Canada's Total Compensation Strategy and Program - Research Paper Example This paper illustrates that Petro-Canada is a public organization producing oil and gas organization and taking part in all of the upstream and downstream operations. The company is known for exploring for and producing energy not only locally but also internationally. It has as many as 1,323 retail outlets which supply petroleum products and services across the nation. Headquarter of the company is located at the in downtown Calgary in Alberta. In the year 2008, the total revenue of the company was $27,785,000, while its employee strength was 6,088. The oil and gas industry in Canada happens to be highly competitive having strong competitors like Encana etc. The objective to increase strength and emerge as a larger oil and gas company the company decided to merge with Suncor in the year 2009. However, now it operates as a subsidiary of the parent company, Suncor Energy. The cash compensation received by an Applications analyst I in Petro-Canada is CDN$75,000-85,000 (Tang, 2010). Thi s is a much higher amount as compared to the average market rate which is $50,795. Thus it can be said that the company has a lead policy in this regard. Apart from having an attractive salary the company also has a scheme of sharing profits with employees which happens at the end of each fiscal year. The amount of the profits shared with the workers depends on the performance of the company at that financial year. As per the rules of the company an Application Analyst I is able to earn an amount of 10% of his base pay as profit sharing. In this way, an employee could earn as high as 15% to 20% when the company has a successful performance in a year.

Business Law Ethics - Utilitarianism, Kantian and Virtue Ethics Case Study

Business Law Ethics - Utilitarianism, Kantian and Virtue Ethics - Case Study Example The waiters are university students who need to pay their university bills; Mike the chef is the sole breadwinner of his family who fends for his young family. (Hoffman, Frederick & Schwartz, 2014). If the business is closed due to its bad hygiene, the customers may shun from the restaurant even after being reopened. The loyal customers might feel cheated and disappointed due to the unhygienic food they have frequently been served (Hoffman, Frederick & Schwartz, 2014). The closure of the business will affect the surrounding community due to its bad reputation. The community provides the business with labour and other social values like goodwill, which when broken would be so hard to replace (Hoffman, Frederick & Schwartz, 2014). By the restaurant being closed, the local government may lose its periodical levies due to lack of operation of the restaurant. The government depends on fiscal policies like taxes to implement its strategic and short-term objectives (Hoffman, Frederick & Schwartz, 2014). Ted should remit the $500 bribe in order to maintain the happiness of his key stakeholders to avoid future problems. The stakeholders would greatly suffer socially and financially in case Ted refuses to part with the amount. (Hoffman, Frederick & Schwartz, 2014). In Kant theory, actions should be governed by the accepted principles of Maxims. Universal acceptability will not conform to Ted’s issuance of the bribe due to its negative perception globally. In terms of respect, Ted respects the well being of his employees and that’s he should pay to safeguard their future (Brenkert & Beauchamp, 2010). When formulating a maxim against bribery and later testing it against the categorical imperative, two results are realized. The first maxim fails in Universal acceptability because bribery is an economic crime worldwide. The second maxim against respect conforms to the categorical imperative; this is due to Ted’s respect to his key stakeholders.  Ã‚  

Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Information Technology Analysis Term Paper Example | Topics and Well Written Essays - 1000 words

Information Technology Analysis - Term Paper Example According to Information Systems Audit and Control Association (ISACA) the five major components of IM / IT governance are:strategic alignment, value delivery, resource management, risk management and performance measurement (ISACA, 2009). Strategic alignment: In a health care organization,suppose a hospital, strategic alignment is when the corporate business goals of the hospital and its departmental or functional goals are aligned with each other. More specifically to achieve strategic alignment, what the top management has to work upon is making a set of attainable goals and objectives and communicate them to all the subordinate department heads so that the narrowed down departmental operational goals are aligned with the more broader corporate ones. As a result when IT operations help to achieve the hospital’s overall desired strategic goals, whether they are providing best quality healthcare services to patients, maintaining healthy hospital environment, providing fast an d efficient healthcare services, etc., the health care quality to the end customer (patients) will be improved. Value delivery: Values are the organization’s fundamental underlying aims and goals based on which the IT strategies, policies and plans are structured so that best possible decisions can be made to guide operations. IT governance delivers maximum value and improves healthcare quality when while making an IT based decision, the alternative with higher value is chosen. For example, one decision might increase customer satisfaction; the second alternative decision might increase hospital’s revenue while the third might increase both. Logically, the third alternative should be opted for, so quality is improved with best value delivery. Value delivery is contingent to management’s decision making. Resource management: It is quite obvious that IT departments or projects require a reasonable amount of resource investment including human resources, capital, t ime, space, etc. IT governance involves managing resources and making intelligent decisions so that the quality of health care is improved with optimum resource allocation i.e. getting maximum value from resources allocated at lowest cost so that healthcare is improved (Weill & Olson, 1989). Risk management: Risk in IT governance has three levels: innovation, agile execution and cost efficiency (Mueller et al, 2008). For an IT decision to be at its least risk so that healthcare is improved the most effective level is cost efficiency because on the scale of risk versus time elapsed, cost efficiency is when the IT decision bears least risk as compared to the other two levels. Although, it is to be noted that for every new IT project in any healthcare organization the risk level is highest if the idea is supposed to bring a strikingly abrupt change initiative. For example: shiftinga hospital’s completely manual patient-file-system to an enterprise databasewill drastically improv e healthcare quality but will have high risk involved. Again, it is the management’s decision that evaluates value versus feasibility. The best decision is then, the one that maximizes value and improves healthcare quality minimizing risk to the least. Performance measurement: IT governance improves quality of healthcare when appropriate performance measures are used to evaluate whether the

Comparison of the entrepreneurial journey made by Skype and Groupon Essay

Comparison of the entrepreneurial journey made by Skype and Groupon - Essay Example Microsoft Corporation most recently acquired the company in 2011. It has operated as their wholly owned subsidiary system since then. However, the licensing and operations of the software continue to be provided by Skype Technologies (Markovich and Krieger, 2010). The company is a limited liability company. Skype was originally developed to offer voice over IP services (VOIP) from the first release in 2003. This provided users a means to make calls over the internet, computer to computer or from computer to telephone at reduced call rates. The company also offers services such as calling landline/mobile phones to and from Skype by offering a Skype Number to their users. The services offered are the main source of Skype’s revenue. Groupon is a globally known e-commerce marketplace, which connects millions of their subscribers with local merchants. This is done by offering a range of business activities, travel opportunities, sales of goods and services in more than 47 countries. The company was launched in November 2008 in Chicago. By October 2010, the company had over 35 million users (registered). Andrew Mason created the original idea behind Groupon. Groupon, Inc. is the world’s largest online coupon provider currently. Both companies have received numerous takeover offers but not all have responded the same.

Information Technology Analysis Term Paper Example | Topics and Well Written Essays - 1000 words

Information Technology Analysis - Term Paper Example According to Information Systems Audit and Control Association (ISACA) the five major components of IM / IT governance are:strategic alignment, value delivery, resource management, risk management and performance measurement (ISACA, 2009). Strategic alignment: In a health care organization,suppose a hospital, strategic alignment is when the corporate business goals of the hospital and its departmental or functional goals are aligned with each other. More specifically to achieve strategic alignment, what the top management has to work upon is making a set of attainable goals and objectives and communicate them to all the subordinate department heads so that the narrowed down departmental operational goals are aligned with the more broader corporate ones. As a result when IT operations help to achieve the hospital’s overall desired strategic goals, whether they are providing best quality healthcare services to patients, maintaining healthy hospital environment, providing fast an d efficient healthcare services, etc., the health care quality to the end customer (patients) will be improved. Value delivery: Values are the organization’s fundamental underlying aims and goals based on which the IT strategies, policies and plans are structured so that best possible decisions can be made to guide operations. IT governance delivers maximum value and improves healthcare quality when while making an IT based decision, the alternative with higher value is chosen. For example, one decision might increase customer satisfaction; the second alternative decision might increase hospital’s revenue while the third might increase both. Logically, the third alternative should be opted for, so quality is improved with best value delivery. Value delivery is contingent to management’s decision making. Resource management: It is quite obvious that IT departments or projects require a reasonable amount of resource investment including human resources, capital, t ime, space, etc. IT governance involves managing resources and making intelligent decisions so that the quality of health care is improved with optimum resource allocation i.e. getting maximum value from resources allocated at lowest cost so that healthcare is improved (Weill & Olson, 1989). Risk management: Risk in IT governance has three levels: innovation, agile execution and cost efficiency (Mueller et al, 2008). For an IT decision to be at its least risk so that healthcare is improved the most effective level is cost efficiency because on the scale of risk versus time elapsed, cost efficiency is when the IT decision bears least risk as compared to the other two levels. Although, it is to be noted that for every new IT project in any healthcare organization the risk level is highest if the idea is supposed to bring a strikingly abrupt change initiative. For example: shiftinga hospital’s completely manual patient-file-system to an enterprise databasewill drastically improv e healthcare quality but will have high risk involved. Again, it is the management’s decision that evaluates value versus feasibility. The best decision is then, the one that maximizes value and improves healthcare quality minimizing risk to the least. Performance measurement: IT governance improves quality of healthcare when appropriate performance measures are used to evaluate whether the

Engineering and Technology versus the natural Environment Essay

Engineering and Technology versus the natural Environment - Essay Example More recently of course, particularly during the late 19th century and early 20th century, a great array of scientific and technical discoveries were made which directly affected the way in which mankind viewed its environment as something to be changed to meet its needs and desires more conveniently. With engineering innovations came bigger houses, transportation systems, increased infrastructure and urban development. All of these things, once made apparent to mankind, did not remain novelties for long, but soon became seen as essential and a practical and fundamental aspect to civilised living, without which, human needs were not being met. The famous psychologist, Abraham Maslow explains this shift in thought in his ‘hierarchy of needs’ theory (1973). This theory explains that human needs are based upon which needs have already been met. At the bottom of the hierarchy, are the more physical human needs of shelter and nourishment. When these are difficult to come by, they are essentially all that is felt to be ‘needed’ by the individual. It is only when these needs are met, that the person feels a need for something else, which according to this theory, would be things like friendship and family. At the top of the hierarchy, are much more emotional needs such as self-actualisation, professional achievement and similar. The point is, as the world became built up and urbanised, and more tools and aesthetic factors thus became more common, people’s needs and expectations fundamentally changed.... de apparent to mankind, did not remain novelties for long, but soon became seen as essential and a practical and fundamental aspect to civilised living, without which, human needs were not being met. The famous psychologist, Abraham Maslow explains this shift in thought in his ‘hierarchy of needs’ theory (1973). This theory explains that human needs are based upon which needs have already been met. At the bottom of the hierarchy, are the more physical human needs of shelter and nourishment. When these are difficult to come by, they are essentially all that is felt to be ‘needed’ by the individual. It is only when these needs are met, that the person feels a need for something else, which according to this theory, would be things like friendship and family. At the top of the hierarchy, are much more emotional needs such as self-actualisation, professional achievement and similar. The point is, as the world became built up and urbanised, and more tools and aes thetic factors thus became more common, people’s needs and expectations fundamentally changed. Quite paradoxically, as the world has radically shifted in its desires to become increasingly civilised, archeologically impressive and technologically convenient, so too has the global interest in maintaining the natural environment. In recent decades, the adverse impact that technology and engineering has had upon the natural environment has become increasingly apparent and worrisome, as rainforest destruction is widespread and climate changes have reached shocking levels. Environmental groups have long been urging people to acknowledge the crucial importance of maintaining the natural environment, not just because of the vital role that its elements play in sustaining life, but because of its beauty and

Andrea Jung Ceo of Avon Essay Example for Free

Andrea Jung Ceo of Avon Essay Andrea Jung CEO of Avon By: Theresa Bell Andrea Jung CEO of Avon Abstract Andrea Jung has had many executive positions during her career as a vice president, merchandising manager, general merchandising manager, senior vice president and general merchandising manager, executive vice president and is now Avons CEO, a Fortune 500 company, and has been for almost the last decade. She is Avons first female CEO since it began in 1886. Andrea Jung has introduced new technology to the company and a new line of make-up. The cosmetics are now being sold in 143 different countries brining its profits up 41%. She gave Avon a revamp when she took over gaining trust, reliability, and gaining a competitive advantage over their competitors. She used a low-cost business-level strategy to gain the advantage over the competitors. The way Avon sales their product has not changed it still sales product by a door to door method, but they used new technology to go worldwide making the company more profitable. In 2011 Avon profit has dropped 18% making stakeholders question Andrea Jungs business-style management skill today. Avon needs a new plan inorder to gain the advantage over their competitors and this leads the stakeholders to question Andrea Jungs focus on management. Theresa Bell Keiser University Ron Phillips/Principles of Management December 6, 2011 Andrea Jung CEO of Avon From the start, Avon embraced the revolutionary concept of women’s economic empowerment, and this continues to be the driving force for Avon. Building on this rich heritage is Avon’s broader commitment to corporate responsibility and the company’s role as a global citizen. Added to the core commitment to women are two additional pillars of Avon corporate citizenship: philanthropy and environmental stewardship, supported by policies and programs across the companys entire business enterprise to ensure that Avon holds true to its mission and vision. (http://www. avoncompany. com/corporatecitizenship/corporateresponsibility/index. html) Andrea Jung is the Chairman and CEO of Avon and has been for almost a decade, in 2005 she ranked number 5 in the top 50 most powerful women at the age of 48 years old (http://money. nn. com/popups/2006/fortune/mostpowerfulwomen/7. html ). Andrea Jung took over as CEO, after Charles Perrin had problems within the company serving as its CEO for only two years. In 1999, Jung took over as CEO becoming Avons first female CEO since the company began in 1886. Since Jung has taken over as CEO, Avon has gone internationally selling worldwide, instead of just being sold to American women. Jung started a new line of make-up directed at teenage girls and college-age women to build Avons revenue and to gain younger customers. In doing this Jung has taken Avon in a different direction, Avon is now being sold in 143 countries, women selling directly to buyers, and selling worldwide this has brought more business into the company making it a more profitable company. Since Jung started selling worldwide nearly 40 percent of sales are from South and Central America. (http://www. notablebiographies. com/supp/Supplement-Fl-Ka/Jung-Andrea. html). Avon is now being sold in Mexico, Russia, and Canada, taking the company into a more competitive market. Jung has brought technology into the company focusing on the product sold to gain an advantage over their competitors. In her first five years as CEO, Andrea Jung gave Avon a badly needed facelift. Revenues rose from $5. 3 billion to $7. 7 billion, and profits nearly tripled The business style she used was low cost. Avon had taken the advantage over their competitors when Jung took over as CEO in 1999. Jung was responsible for the profits almost tripling using her business style of management. Today Andrea Jung is under fire by the stakeholders due to a drop in sales. Avons sales have dropped by 18% leaving them to question Jungs business management style. The company is in need of a turn around plan to gain the advantage over their competitors. The company is under two different investigations to find out if the company bribed officials overseas from Latin, and China. Jung is working on a long-term plan to fix the problems that the company is suffering from today. http://www. appleinsider. com/articles/11/10/28/apple_board_member_andrea_jung_facing_scrutiny_at_avon. html   http://www. avoncompany. com/corporatecitizenship/corporateresponsibility/index. html   http://money. cnn. com/popups/2006/fortune/mostpowerfulwomen/7. html http://www. notablebiographies. com/supp/Supplement-Fl-Ka/Jung-Andrea. html   http://www. appleinsider. com/articles/11/10/28/apple_board_member_andrea_jung_facing_scrutiny_at_avon. html.

Steganography, Cryptography And Watermarking

Steganography, Cryptography And Watermarking Steganography has been derived from Greek word Stego which means Covered and Graphia which means writing. Steganography is an ancient technique of covert communication. The earliest form of Steganography has been reported by the Chinese. The secret message was written in very fine silk or paper, and then it was rolled into a ball and covered with wax. The messenger would either swallow the ball or hide it in his nether parts. Herodotus has mentioned in one of his seminal works of history, Histories during the 400B.C about the tradition of secret writing. In his writings he has mentioned about the conflicts between Greece and Persia. A king named Histiaeus encouraged the Aristagoras of Miletus to revolt against the Persian king. He used to tonsure the head of his most trusted servants and tattooed the scalps with secret message and waited for the hair to grow. The servant used to travel between the borders without carrying anything contentious freely. At the reception end his head wou ld be tonsured again and the message will be conveyed. Similarly during the World War II, the Germans invented the use of microdots. Image containing great details were scaled down to the size of microdots. The German usage of secret sharing is regarded as the recent evolution of Steganography. Another example of Steganography is during the Vietman War were the captured US armed force showed hand gestures during a photo sessions to convey some military secrets. The field of Steganography is limitless and any kind of cover media can be used for carrying secret messages. Cover medias can be text, images (grey, binary, color), audio, video etc. An example is illustrated as follows. Siva and Adam dined happily. The following message is not simply a plain text but it carries a secret message within it. By extracting every second letter from each word we derive a secret message as follows. India Other methods of non technical Steganography is using lime and other citrus liquids to write secret data. The message will be imperceptible to the eye. When it is shown over a flame the writings will become perceptible. Steganography is method of information hiding. Steganography can be considered as an art as well as science for secret communication. The best way to explain the purpose of using Steganography is the Prisoner Problem. Now let us consider two prisoners Alice and Bob, and Wendy to be the warden. Now if Alice and Bob want to devise a plan for escaping then they got to communicate with each other. If Wendy is a passive warden then he wont interfere in there communication but if he is an active warden then he will interfere and extract the secret message sent. Hence Alice and Bob got to communicate in such a way that Wendy is not able to decipher there plan. This can be done by the technique of Steganography. Steganography is been used in order to enable secret communication. It is also being used by terrorist for covert communication which is potential for endangering our national as well as world security. Despite the ill effect there are positive sides of Steganography. For example a photographer can store the aperture size, future references etc while taking a picture. Steganography has a wide application in medical imaging were the details of the patients are embedded within the medical image. Similarly Steganography can be used for different friendly applications. It is also used for copy right protection using it along with Watermarking. The use of Steganography also has an important role in strengthening national security. Steganography is defined as secret hiding. It can also be regarded as secret sharing since messages can be shared secretly without being hacked or corrupted. COMPARISON BETWEEN CRYPTOGRAPHY, STEGANOGRAPHY AND WATERMARKING The other forms of data hiding are cryptography and watermarking. Cryptography is a technique in which the secret message is encrypted and sent in an unintelligent format. The basic difference between Steganography and cryptography is that Cryptography scrambles the data whereas Steganography just hides the data. Cryptography scrambles the secret data in such a way that it appears to be gibberish to any unintended user. The secret data to be communicated is a mixture of permutation and substitution and hence any unintended user cant receive the message. Steganography is different from Cryptography. Steganography rather hides the data whereas Cryptography encrypts the data. Steganography provides much more security when compared to cryptography because there is no chance of any unintended user to know that a message is being sent whereas in Cryptography there will always be a suspicion that a message is being sent. Hence these are more prone to be hacked or suppressed. Watermarking is generally used for authentication and copyrights protection. Watermarking can be used for creating a image in order that it is recognizable. It can also be used to mark a digital file so that it is intended to be visible (visible watermarking) or visible to its creator (invisible marking). The main purpose of watermarking is to prevent the illegal copying or claim of ownership of digital media. CHARACTERISTICS OF STEGANOGRAPHY, CRYPTOGRAPHY AND WATERMARKING The common characteristic between Steganography, Cryptography and Watermarking is that they transmit the secret information in such a way that only the receiver is able to decrypt the data. These techniques had been prevalent during the ancient times have been transported to the digital world. It has become nearly impossible to extract or detect the secret messages. In digital domain Steganography and watermarking have a tie and it is majorly used in digital images. These have other uses as well. Both cannot exist by themselves and hence they require cover objects. Steganography requires a cover media to carry the secret information and watermarking requires a carrier object which it is intended to protect. These similarities create a link within them and hence some modifications can lead the transportation from one technique to another. Due the similarities present between these it is difficult to distinguish between the both but actually there is a remarkable difference between the m. Cryptography encrypts data in two methods secure or unbreakable (e.g. One-time pad) systems and breakable (e.g. RSA) systems. Through both the systems communication carried out is known to all. But it is time consuming and often fruitless to crack a code. The robustness of the code lies upon the difficulties faced while reversing the code in different permutations and combinations. Due to its robustness it is used for security purposes. For example Cryptography is used for online shopping, banking etc. The credit card number, expiration etc and other crucial informations are encrypted and sent so that an unintended user cant access the details. Steganography offers high carrier capacity keeping embedded message invisible and maintaining the fidelity of the cover media. The efficiency of the Steganographic method is that one shouldnt know that a media file has been altered in order for embedding. If the malicious user knows if there is some alteration the Steganographic method is defeated and less efficient. The embedded message is very fragile and hence if any modification is done to the stego image th e whole secret message is corrupted. The effectiveness lies on the ability to fool an unintended user. The layers of communication can be more than one layer. A secret message can be embedded with a digital image which in turn can be embedded within another digital media or video clippings. Watermarking is required in order for authentication and copyright protection of digital files. The embedded watermarking is required in an object to make it impossible to remove completely. If the embedded watermarking is removed, then the marked object is either distorted or destroyed making it useless for anyone. This is the reason why watermarking is more robust when compared to the other image processing techniques, such as compression, cropping, rotation etc. hence even if a tiny bit of information is extracted by modification and tempering the rightful owner can still claim ownership. If the owners name is embedded in the digital image and the particular image then the original information is tampered and destroyed. Unlike Steganography, it is acceptable for everyone one to see the watermark embedded in it including the invisible ones. COMBINED EFFORTS OF STEGANOGRAPHY, CRYPTOGRAPHY AND WATERMARKING Cryptography is used as a paisano of the other two data hiding techniques. Data is encrypted in both the techniques in order to increase the randomness of the Steganography to avoid the statistics-based attacks and to protect the hidden data in watermarking. Commonly it is a practice to first encrypt the data and then use any one of the embedded techniques. The importance of watermarking can be stated as follows. Suppose Rs 100 bill is introduced in December 2009 then watermarking is required in order to prevent illegal copies. If the bill is shown in light a small image will appear within the large image. The watermarking is actually a part of the large paper and is visible on both sides. Hence it becomes difficult to produce a paper with such features. In addition to these features some tiny writings which are invisible to the human eyes are present in the paper. A banker having the necessary equipments (magnifying glass) can tell the difference between the original bill and the fake bill. Steganography makes its play here. The tiny printing done on the bill represents Steganography. It is implemented in order to achieve high security. The tiny printing done in the paper cannot be copied since any commercial printer is incapable to print such a fine and thin print leading to black spots. These are the reasons why Steganography is used for high security. Cryptography is actually implemented in the bill. A serial number is been printed in the bill which may contain information about the location and date of bill is printed or any other confidential information. The unique serial number for each bill can be used for tracking purposes. Using Steganography, Cryptography and Watermarking it becomes impossible to reproduce Rs100 bill. It must be kept in mind that all three are different and have different functionality. REQUIREMENTS OF STEGANOGRAPHY Any digital media can be used as a cover media. The cover media can be a text, image (color, gray), audio or video etc. Cover media is required in order to hide and carry the information. Usually digital images are required in order to hide secret messages. The secret message is hidden within the digital image. After the message is embedded within the cover media An innocuous image consisting of scenery, people and other objects are the nominees for cover media. The availability of natural images is not a problem due to the affordable price of digital cameras nowadays. Natural images are the best candidates for cover image since they have higher resolution providing flexibility and other necessary need. Images are selected because the cover media is selected depending upon how the human visual system works. The gray image consists of pixels with intensity value from 0 to 255. The human eye cannot differentiate between a pixel intensity of 244 and 245. It will appear both the pixel intensities to be same. Also natural image s contains lots of noise and hence there is lots of pixel value intensity difference especially in the edges. This variation in the pixel intensity is known as randomness and can be exploited to embed the data without providing any suspicion to human eye. The human visual system wont be able to distinguish between the image before modulation and the image after modulation. The secret data is embedded within the cover image. The resulting image is called a stego-image. The stego-image will appear to be the same as the original image. The human eye cannot usually distinguish between the stego-image and the original image except there is a significant change between the images. In that case the Steganographic method employed is ineffective. Hence there are certain Stego-system criteria which we have to follow while doing a Stegagraphic implementation. They are stated as follows. The major criteria of Steganography that the cover media shouldnt be significantly altered or modified. The embedded data should be directly encoded in the cover and not in the header or wrapper. The embedded data should be immune to modifications of the cover. That is if the cover media under goes any change then data embedded within it should be unaltered. During transmission there are chances of noise to occur and hence distortion due to noise cannot be eliminated. Due to this issue error coding algorithms should be included where ever it is required. It is advisable to avoid the suspicious portions while embedding the message in the cover. This because after embedding in these regions they become open to suspicion. For example by embedding in smooth portions of the image, the resultant image becomes distorted and open to suspicion. Hence such portions are often avoided and portions where there is variation in the pixel intensity are preferred. The embedding efficiency must be improved. Efficiency of the embedding capacity depends upon the number of pixels in the image used for embedding purposes. The stego-image should be robust to steganalysis. Steganalysis is a method of identifying the difference between the original image and stego-image. Using steganalysis one can derive the information about the secret message. The stego-image should reassemble the original image and there should be any suspicion. The cover image should have high carrier capacity. That is the embedding capacity should be large. The amount of information present in the image should be resistant to distortion and should be comparable to the number of pixels present in the image. The three basic requirements of Steganography are robustness, capacity and imperceptibility. All these requirements should be satisfied for having an effective Steganographic method.

H G Wells :: Biography

Herbert George Wells English author and political philosopher, most famous for his science-fantasy novels with their prophetic depictions of the triumphs of technology as well as the horrors of 20th-century warfare. Wells was born September 21, 1866, in Bromley, Kent, and educated at the Normal School of Science in London, to which he won a scholarship. He worked as a draper's apprentice, bookkeeper, tutor, and journalist until 1895, when he became a full- time writer. Wells's 10-year relationship with Rebecca West produced a son, Anthony West, in 1914. In the next 50 years he produced more than 80 books. His novel The Time Machine mingled science, adventure, and political comment. Later works in this genre are The Invisible Man, The War of the Worlds, and The Shape of Things to Come; each of these fantasies was made into a motion picture. Wells also wrote novels devoted to character delineation. Among these are Kipps and The History of Mr. Polly, which depict members of the lower m iddle class and their aspirations. Both recall the world of Wells's youth; the first tells the story of a struggling teacher, the second portrays a draper's assistant. Many of Wells's other books can be categorized as thesis novels. Among these are Ann Veronica, promoting women's rights; Tono-Bungay, attacking irresponsible capitalists; and Mr. Britling Sees It Through, depicting the average Englishman's reaction to war. After World War I Wells wrote an immensely popular historical work, The Outline of History. Throughout his long life Wells was deeply concerned with and wrote voluminously about the survival of contemporary society. For a time he was a member of the Fabian Society. He envisioned a utopia in which the vast and frightening material forces available to modern men and women would be rationally controlled for progress and for the equal good of all.

“Mother Tongue” by Amy Tan Essay

In â€Å"Mother Tongue† by Amy Tan, Tan explores the connection between one’s language and their identity, she examines not only how language affects the development of ones identity, but also the role it has in the way one is perceived by society. Tan shares a few anecdotes illustrating the role language played in shaping her own personal identity. â€Å"I think my mother’s English almost had an affect on limiting my possibilities in life as well.† Tan goes on to explore the idea that the â€Å"broken English† she heard spoken by her mother at home ultimately led to her doing poorly in English, at least when compared to her science and math scores. This led her teachers to steer her away from writing and more towards math and science. In Tan’s case her â€Å"rebellious nature† led her to become an English major her first year of college. Many other Asian-American students are not as headstrong as Tan and therefore are often pushed int o careers in math and science, this undoubtedly affects one’s identity as careers are a major component of an individual’s life. Another way language can be seen affecting Tan’s identity in mother tongue is in the way tan uses, interprets, and thinks about words. â€Å"Her language, as I hear it, is vivid, direct, full of observation and imagery. That was the language that helped shape the way I saw things, expressed things, made sense of the world.† Here Tan was refering to the language of her mother, which obviously played a huge role in how Tan herself interpreted and used words. The final connection between language and identity that can be ascertained from this piece is how often the assumptions about one’s identity made based upon the way they speak are often false. This was very much the case for Tan’s mother, towards the beginning of the piece Tan makes it clear to the audience that while her mother’s English may be â€Å"limited† this in no way reflects how much English she comprehends. Tan also discusses how, when she was growing up, her mother’s â€Å"limited† English limited Tan’s perception of her, â€Å"†¦because she expressed them imperfectly her thoughts were imperfect.† was the logic behind Tan’s view of her mother when she was growing up. This was the view most people seemed to have of Tan’s mother, which is an incorrect perception of her mother’s actual intelligence and comprhension of the English language.

Salem Trials: A Lesson from History

Salem was taken from the word, â€Å"Jerusalem†, seat of Christianity. This is where Christ trudged on and lived a holy life but became ironically symbolized in America by people become crazy. It has gained notoriety due to cruelty that pervaded in 1692 in that village in Massachusetts. â€Å"Time is the Mother of Truth and Truth the Daughter of Time† (Hale), scholars have studied documents surrounding that incident in Salem. The truth was told through documented events of those fateful days when those innocent people were tagged as ‘witches’. The people of Salem acted on suspicion without substantial bases for accusing one hundred fifty villagers of a crime that is ‘witchcraft’. They have admitted to a mistake that was horrible, became a controversy for ages, and a lesson for humanity. (Hale) Several factors influenced the villagers to act in such frenzy: politics, religion, and hysteria. For lack of a strong leader who can effectively give direction to the people’s thinking, the incident went out of hand. Even the leaders themselves were controlled by the situation, perhaps, due to hidden interests as well. P. S. Nissenbaum) Internal bickering in the community is not exceptional for it also occurs in other New England communities at that time. Add to it a weak institution that can handle the population. They were claiming to see an apparition of the witches at their beds. (P. B. Nissenbaum) Having them hanged will not make any difference using that argument. The devil can harm them in whatever form us ing their kind of thinking. It is incomprehensible how individuals can be united to wreak havoc upon other individuals. People of such ignorance have been put together to teach humanity how extremism and stupidity can cause such a tragedy. The lives of the people who were innocent of a crime that is witchcraft which was not proven enough were put to waste due to the cruelty that beset upon them. They had to suffer in jail and have to go through torture because their co-villagers were obsessed with the idea of a devil that is lurking around their lives and is causing an illness which they do not understand. They used the words: â€Å"fits†, â€Å"odd postures†, â€Å"foolish, ridiculous speeches†, â€Å"distempers†, etc. o describe what are being manifested by the victims of witchcraft as they said. (P. S. Nissenbaum) One was seen crawling on the floor during an attack. (P. S. Nissenbaum) The symptoms that were being manifested by the said victims of witchcraft could be epilepsy. This illness has always been associated with demonic possession which can not be cured. The stig ma that can be brought upon the individual experiencing this can be enormous that it is convenient to blame it on somebody performing witchcraft upon him/her experiencing it. This can be genetic and in Salem during that time, having fifteen children in a family was the average. It is not negligible to note that this disease could be running in families. Not to mention the hysteria that came with it. Children were manipulated by adults to say things or even their musings were interpreted to mean according to how they wanted it to mean. (P. S. Nissenbaum) The colonies of England included Massachusetts which was under the laws that govern these colonies. In England, witchcraft was a capital crime as declared in 1641. Chronology of Events Relating to the Salem Witchcraft Trials) Anyone suspecting of witchcraft activities were hanged by the stake. The colonial village of Salem was a staunch believer of the Bible. They took to the letter every bit of the Scriptures. They have become extremists that they have forgotten that ‘love’ was taught by Christ primarily. The ministers who were at a loss in governing the villagers conveniently blame witchcraf t as the culprit in the disunity eminent among the folks. Disputes led the villagers to falsely accuse innocent citizens in response to the hysteria that pervaded them. The early ministers who led them were also blinded by their desire for territory. It was a difficult time for this colonial town. Land was getting scarce while families were becoming big. They work very hard on their farms only to be obliterated by blights. (P. S. Nissenbaum) Children were not allowed to play: girls were taught to spin yarn and help in the household while the boys were brought by the men to help them to hunt. They did not have the opportunity to play as normal children would. These children were deprived of the happiness of childhood. It is not surprising if they would deliberately act out abnormal behavior because opportunities to play were rare. It is possible that acting out those eccentricities was a form of ‘play’ for these deprived children. Their sense of awe and wonder were suppressed by the adults. Their words were twisted by the older ones to serve their purpose. (P. B. Nissenbaum) They lived at a time when there were no other forms of entertainment but chores. It was also a time for New England to be established. Institutionalizing law and order was especially difficult in this part of the colony. Political disputes were prevailing in terms of who would minister the community. They were like a flock in need of a shepherd. But the shepherds who should be taking care of them also have vested interests. They carry within them their wants and needs. The chronology of events is very telling about man’s desire for power and control. The judicial system was used and manipulated according to the whims of the judges. (Chronology of Events Relating to the Salem Witchcraft Trials) The humble investigation of John Hale speaks of how erroneous the system is in handling the cases in Salem. With all humility he explained that what transpired in Salem was a lesson learned for humanity. Quoting from the Scriptures, he reiterated that the innocent must not suffer. (Hale) The evidence against them was obviously weak based on spectral evidence that Governor Phipps opposed. (Chronology of Events Relating to the Salem Witchcraft Trials) He was able to save lives due to be hanged in the Gallows. After fourteen years, one of the accusers, Ann Putnam, publicly apologizes for her actions in 1692. The event in 1692 was very unfortunate for the people in Salem. Hysteria emanated in that village due to numerous factors. One would see how religious extremism can drive people to do harm towards others which are contrary to the teachings of religion. Greed and desire for power can attribute to people’s insensitivity and delusions. It was formally admitted as a mistake by the government of Massachusetts in 1957 (Chronology of Events Relating to the Salem Witchcraft Trials) and a good reminder for everyone of the cruelty that occurred centuries ago. This is a lesson learned which must be avoided. It is important that judicial system must be respected by honoring facts; biases must be avoided; and the right to be represented must be observed. Law and order are present for people’s protection. These should not be used to cause harm to a nation’s citizens. Leaders appointed are also responsible of the people’s safety. They must safeguard the lives entrusted them. It is important for them to ensure that due process must be served in the courts. This incident must never happen again.

Poverty, the Never-ending Disease Essay

Poverty is a lack of goods and services needed to maintain a minimal adequate standard of living. The definition of the term adequate varies, however, with the general standard of living in a society and with public attitudes toward deprivation. No university accepted the definition of basic needs exists because poverty is a relative concept. In poorer countries it means living at the brink of subsistence, while in our country few improvised families confront starvation, although many suffer from undernourishment. Not everyone is born into a life of the rich and glamorous. Those who are fortunate enough know that they are very lucky to be in their position. Others however are totally in different situations. They need to fend for themselves and having meal is something which comes only once a day. Malnutrition is the obvious result of not consuming the right amount of food. This will lead to outbreaks of diseases but in poverty stricken countries there are no hospitals to cure this. Lacking infrastructure means lacking educational rights. People who are living in poverty cannot afford to send their children to school so this will mean an unclear future for their children hence the undernourishment. Furthermore, living in crowded areas, this has a tendency to increase the chances of disease as people are drinking from unsafe sources of water. People around the world are not aware of how immense this issue is and sometimes hesitant to believe the scale that it has risen to. Without understanding the people living at a disadvantage from the rest, there is no cure for the problem. Poverty is not only the problem of the poor, but the rich as well. If the wealthy becomes too concentrated and there are too many people at the low end who can’t contribute to the cost of society (taxes to maintain infrastructure for instance) then more of that burden must fall to the wealthy. The wealthy that derive their wealth by selling goods and services to a mass market will be affected if the market dries up because too many individuals are too poor to be able to buy the goods/services. With hints of the invisible hand playing a role in this, it’s possible that the economy might not adjust to the buyers and sellers. People suffering from poverty may become enraged at the disparity between themselves and the wealthy and may express that rage through a violent revolution and redistribution of wealth. Some wealthy individuals may feel concern about such a disparity and choose to give some of their wealth to better the condition of the poor or to help the poor find a way to prosperity. Poverty in the United States has long been a social, political, and human rights issue. Few people would say that it is not our moral duty, as social human beings to take care of those less fortunate than ourselves, to the best of our ability. These types of people have what is called a â€Å"libertarian†. There is really no specific definition of â€Å"libertarian†, but it is associates justice with liberty. In relation to the matter at hand, specifically poverty in America, libertarians are against taxing the affluent or forcing people to aid the starving and poor. One of the most influential libertarians of our time is Professor Robert Nozik. His theory of justice begins with the principle that all people have rights, which require that we refrain from interfering with others. Other than this we have no obligation to do anything positive for anyone else, and likewise, they have no obligation towards us. These rights are natural or inalienable because all humans have them and they do not come from any social or political institutions. These rights forbid us from interfering with a person’s liberty even if it would promote some general good, or prevent another’s rights from being violated. Overall, the general idea is that people have the liberty to live a life free from intervention of others, and can lead their life however they so choose. In addition, he says that if a person acquired their fortune or possessions without harming, defrauding, or violating the rights of any others, then it is morally permissible to use those things however one wishes. This includes wasting, willing, or endowing the possessions to someone else. Even though many people are dying from starvation and malnutrition, Nozik’s theory of justice states that one has no obligation to help those people. His theory is summarized as follows: 1. A person who acquires a holding in accordance with the principle of justice in acquisition is entitled to that holding. 2. A person who acquires a holding in accordance with the principle of justice in transfer, from someone else entitled to the holding, is entitled to the holding. 3. No one is entitled to a holding except by (repeated) applications of 1 and 2. Relating to poverty, libertarians feel that no matter how the actual distribution of economic holdings may look, if all involved are entitled to the holdings they possess, then the distribution is just. Although Nozik’s theory concentrates on the just of distribution, Rawl’s theory of the difference principle can be thought of as the similar concept. The main moral motivation for the Difference Principle is similar to that for strict equality. The overwhelming economic opinion though is that in the foreseeable future the possibility of earning greater income will bring forth greater productive effort. This will increase the total wealth of the economy and, under the Difference Principle, the wealth of the least advantaged (the poor). The inequalities consistent with the Difference Principle are only permitted so long as they do not compromise the fair value of the political liberties. So, for instance, very large wealth differentials may make it virtually impossible for poor people to be elected to political office or to have their political views represented. These inequalities of wealth, even if they increase the material position of the least advantaged group, may need to be reduced in order for the first principle to be implemented. The difference principle may be the solution to poverty in the near future, but sadly the idea of strict equality between individuals will be a difficult concept for people to grasp. Capitalism is a system designed to produce for private profit, not for public need. We have gotten as far as we have due to decision-making of corporate boardrooms and placing them under the democratic control of the majority that the economy can provide for our needs. To do that, we need to bring into public ownership the largest 500 corporations and financial institutions. If the assets of these giant companies were under our democratic control, then investment and resources could be democratically controlled by working-class people. Resources would be available to address our most pressing social problems and allocated to areas of most need. To achieve this means breaking from giving any support to the two big-business political parties – the Republicans and Democrats. They are both fully implicated in creating the present mess we are in. We need to build a new political party to represent our interests as workers, the poor and young people, and which points a finger at the real villains, the super-rich and the capitalist system.

Gilded Age Essay Example | Topics and Well Written Essays - 750 words - 1

Gilded Age - Essay Example Mark Twain coined the tem â€Å"Gilded Age† in the last decades of the nineteenth century. Gilded Age refers the era that followed the American Civil War, stretching from the end of the reconstruction period to the dawn of the twentieth century. The era was characterized by enormous economic growth and European investments. Ideally, the Gilded Age was an era of transforming America into a liberal country. Outstanding events that characterized the era included increased immigration, industrial growth, and construction of railway networks. The Gilded Age cannot be considered as a Golden Age for Americans instead, the age symbolizes an era of unsolved problems. In The Gilded Age: a Tale of Today, writers Mark Twain and Charles Dudley confirm that Gilded Age was an era of severe social problems (Biography web). According to the authors, these problems could not be visualized since they remained beneath a thin layer of the supposed gold. In this context, gold symbolizes the economi c and social developments that accompanied Gilded Age. Golden age refers to an era of peace prosperity, stability, and harmony. Unfortunately, the Gilded Age was characterized by neither stability nor prosperity (Zinn 32). In particular, the period can be considered as an era of great economic oppressions as Americans struggled to rebuild their country. To the American, the Gilded Age was an era of exorbitant taxation. American economy became more intertwined with cotton and tobacco exports. The prices of these commodities reduced dramatically affecting the livelihood of ordinary American farmers. Although the country experienced a GDP growth, per capita income remained minimal. Unsolved problems in the agriculture sector included the slave question, the north, and south states issue. These problems were covered under increased exports to the European market and the rise of mechanized farming. Unsolved economic problems became the basis of more sophisticated social and political pro blems. Gilded Age politics were characterized by intense completion between political parties. The third party system promoted intense competition Between the Democratic and the Republican Parties. Consequently, minor parties including the Labor and Farmers unions disappeared as soon as they were established. Intense competition between the two parties intensified the country’s political temperature. Indeed, Americans were divided between Republicans and Democrats (Zinn 54). Both parties established the supposed â€Å"Political Machines† to oversee elections, reward their royalists and buyoff their opponents. Consequently, the wining party becomes the sole controller of state and government’s jobs, contracts and business openings. The â€Å"spoils system† was also a major source of political influence. Elected candidates were expected to pray according to the instructions of their political spoils/sponsors. For example in 1876, Hayes was elected in a secr et deal to be the new president of the United States. In addition, Harrison won the elections without winning the popular vote. Thus, the US did not achieve any form of political stability during the gilded age. Indeed, the era was a cover-up for the political instabilities that characterized the country. The era is considered the most turbulent time in American political history. Political reforms that promoted multiparty democracy and high voter turnout, acted as a conspiracy for politically motivated scandals, political rivalry, and civil unrest. Thus, the Gilded Age can never be considered as the US’s version of the Golden Age. Social developments also remained unattended during the Gilded Age. During the gilded age, discriminations against the black Americans intensified. Black Americans living in the southern states experienced the worst form of discrimination. The black communities were stripped off their political and voting rights. Ideally, the system almost revived slavery despite slave trade and slave labor having been abolished. During the

Undecided Assignment Example | Topics and Well Written Essays - 250 words - 1

Undecided - Assignment Example Women in Athens could not own property or vote for leaders. Their principle role was to be housekeepers. They were not allowed to participate in any public function. In contrast, the Spartan women enjoyed more freedom and could own property. They were allowed to inherit property and were encouraged to develop their intellect (Unger 26). The two cities of Sparta and Athens were bitter rivals in the ancient times in Greece. They were very close to each other but different in their lifestyles and values. The Athens city was open to all citizens and recorded a total population of more than 3,761,811 people. In contrast, the city in Sparta was limited to its inhabitants while the total population was 18, 184 people (Unger 23). Wisdom and restraint in Athens was sorely missed among the Pericles. According to (Unger 78), wisdom in Athens existed in theory while this was highly appreciated in Sparta. The Spartans observed many values which controlled their lives. They gave great honors to certain events and to people with respect to their withheld values and

Language development Essay Example | Topics and Well Written Essays - 250 words - 1

Language development - Essay Example In all of these aspects of language acquisition, language imbalance should be considered when gauging the extent and ability of child in the process of learning a second language. Language imbalance is brought about by a conflict between two or more languages that a child is exposed to in the development process (Hoff, 2009). Influences on vocabulary are characterized by a myriad of factors in a child’s life both at school and at home. Vocabulary development is influenced by language socialization that takes two general styles of child-rising that are child-centered and situation centered. In child centered approach, adults use two strategies of self-lowering through baby talk and child rising by interpreting unintelligible gibberish(Barrett, 1999). The situation-centered approach does not require adults to simplify their language, but children are expected to learn, understand and produce adult like speech mannerism. The culture surrounding a child has a significant influence on the development of language in a child because it influences the development of their identity. Cultural influencers, in society, determine the personality and identity that a child forges for self in line with what the societal norms dictate (Barrett, 1999). Young English language learners should be encouraged by their educators, caregivers and parents to achieve a more rounded language development process. Teachers need to be good models of language use and encourage learners to interact with other children as much as possible (Hoff, 2009). This is aimed at reinforcing their vocabulary repertoire. Second language learners can be exposed to meaningful learning activities that encourage them to practice their new language

Dark Water Essay Example | Topics and Well Written Essays - 2250 words

Dark Water - Essay Example In Japanese horror it relies more on folklore and psychological themes that make the plot very different from western movies. The popularity of these horror movies even got up to the point where the American movie industry does remakes of them. The movie that was credited at starting the wave of popularity of this genre is The Ring, also directed by Nakata. The difference in Japanese horror is the unique way that folklore and technology is integrated into the movie. Moving in and getting acquainted with the neighbors The movie Dark Water is about a mother and daughter who move to a run down apartment complex who starts having paranormal encounters upon. The mother had just gotten divorced and was going through a difficult moment in her life. The movie itself, like others in its genre is full of references to Japanese folklore. One such reference is the spirit of the dead child that comes back and haunts the living. In Japanese folklore it is very popular for a spirit of a child who d ies to come back and haunt the living in order to exact revenge in very violent ways. The child is Mitsuko, who dies the previous year from drowning due to the neglect of her mother who was not able to fetch her from school, she goes home alone and plunges into the water tank of their apartment and dies. This theme figures heavily Japanese folklore. ... In the end she dies protecting her daughter from Mitsuko. This is related to the vengeful fetus stories that also figures in Japanese folklore. Here the spirit of an aborted fetus comes back to haunt the mother. The only way to stop this is through a ritual or proper burial. Another way to appease these spirits is through self sacrifice of the mother which happened to Yoshimi. Another theme that has been incorporated here from Japanese folklore is that of the â€Å"monster mother† or the mother who treats her child badly. There are many reasons for this and one reason that comes up is usually the absence of a father, such as the case of Yoshimi and her daughter whom she neglects and treats badly in the movie. One of the reasons for her neglecting her child is quest to look for a job to provide for both of them. Another is the mental anguish the divorce proceedings are causing her. These two combine for a very volatile personality and make for a mother that is both loving and m enacing at the same time. Yoshimi tries her best to nurture her daughter but the pressures of her current situation bear down on her and make her very unstable. As opposed to the father who is very stoic in his appearances in the movie. Yet another theme that comes from Japanese folklore is the Kappa which is a mischievous spirit in Japanese folklore who inhabits water. It is a humanoid that is the size of a child that lures people into bodies of water. The Kappa is usually blamed for drowning in rivers and also raping women who frequent rivers or bodies of water. The child in the movie is not a Kappa per se but her appearance in one of the scenes is inspired by the Kappa whose color ranges from green to yellow. The fact that she is

The Middle Ground Method of Argumentation Coursework

The Middle Ground Method of Argumentation - Coursework Example The topic in the essay could have been approached in a middle ground argument approach. This would have involved considering both the advantages and disadvantages of mandatory drug testing and settling on middle ground where no side gets it all but each side gets something (Anonymous). This would have necessitated a change of the claim from mandatory drug testing having adverse effects to there being a confidentiality mechanism for the results of drug tests (Anonymous). This middle ground solution would have taken care of stigmatization which is one of the disadvantages of mandatory drug testing and it will allow for testing in favor of the group in support. Additional sources will be needed so as to assist in research of the confidentiality method that can be used to make the middle ground solution a success. Proper application of this middle ground solution would be a success as far as mandatory drug testing is

Nursing Process Essay Example for Free

Nursing Process Essay The client is a 70 year old, Caucasian male who is a retired siding salesman from Riverside, IA, who has an extensive history with Paralysis agitans (Parkinson’s disease). The client was first admitted to the long term care facility in December 2012. The client explained that he came to be at this facility after â€Å"already being in two places like this†. He was removed/discharged from the last long-term care facility for being what he called â€Å"disruptive†. The client described the staff at the last facility as not very kind to the residents. There was an incident where the drugs that were prescribed to the client made him hallucinate and he became unruly with the staff and was restrained and taken to the hospital for evaluation. He was then transferred to this long term care facility. Wanting to gather the client’s health history, an interview was scheduled. In starting the interview with the client, he was asked if he would be comfortable with being asked some questions and was informed that he did not have to answer any questions that he was uncomfortable with. Due to the client’s paralysis agitans and his muscle weakness he is primarily in a wheelchair. The client was asked if there was anything that he needed before starting and if he would prefer the door be closed or the curtain be drawn for privacy, he stated that wasn’t necessary. It was observed that the client had tremors in his right hand and arm. A few minutes after sitting down, the client asked for help moving his hand that was resting on the bed to the arm of his wheelchair; in doing this it seemed to help calm the tremors. When speaking with the client, he is of sound mind and has a sense of humor. This indicates that the client’s paralysis agitans has not affected the area in the right hemisphere of the brain that controls personality. The client noted that he was in respectable physical health until 1996. He then explained that in the spring of 1996, while he was running he suffered from a TIA (Transient Ischemic Attack). The client sought out professional answers from 5 specialists and was diagnosed with Paralysis agitans. The client conveyed this was a concern he had because his father also had Paralysis agitans. The client describes that the Paralysis agitans has  progressively become worse over the past 18 years. It was observed that his speech was slow and monotonous. The client spoke in a low and discreet volume. A lack of facial expressions was also noticed. The client can walk with the assistance of a walker but is generally in a wheelchair. Name of Drug Dosage Route Time Related to Carbidopa-Levo 25 100 tab Orally TID Paralysis agitans Comtan 200 mg tablet Orally TID Paralysis agitans Seroquel XR 50 mg tablet Orally In the afternoon Nonorganic psychosis He is prescribed 3 tablets to be taken orally 3 times a day Carbidopa-Levodopa 25-100 (25 mg of Carbidopa and 100 mg of Levodopa) for paralysis agitans. He is also prescribed 200 mg of Comtan to be taken orally 3 times a day for paralysis agitans. These drugs raise the level of dopamine in the brain. A side effect of having elevated levels of dopamine in the brain is psychosis. The client is also given 50 mg of Seroquel XR orally in the afternoon to alleviate his nonorganic psychosis. It is documented in the client’s chart that there are symptoms of sleep apnea. When asked, the client stated that he was unaware of having that condition. The client does not use a continuous positive airway pressure (CPAP) machine  while sleeping at night. When talking more in depth about sleep patterns and concerns the client stated that he gets approximately 8 hours a sleep a night, this is without any help from sleep aids. When speaking of his bedtime rituals he said that he does have two beers, back to back, at night right before bedtime, while watching television. He does not have difficulty falling asleep but did claim that he sometimes has a hard time staying asleep at night. When questioned about taking occasional naps throughout the day he stated â€Å"depends on if I’ve been up all night†. The client then explained that it is the noise level at the long term care facility that keeps him awake. When inquiring about the client’s family he stated that he has been married for 48 years and has two children, a son who is 44 years old and a daughter that is 39 years old. The client also has seven grandchildren. When asked what he likes to do in his spare time he replied that he loves spending time with his wife and children. He stated that before coming to this long term care facility he enjoyed playing card and gambling. He now plays computer games for fun, when his wife is there to help him. The client explained that he has a â€Å"little bit† of high blood pressure and it was noted in his chart that he is given an 81MG Aspirin daily for atrial fibrillation. Aspirin 81 mg Orally o.d. A-fib Acetaminophen 325 mg Orally Every 6 hour Pain He has no history of heart surgeries or surgeries of any kind. The client reported that he has never had rheumatic fever. When asked about blood clots, the client responded that he believes that his TIA in 1996 was a result of arterial emboli. The client claims that sometimes he has numbness in his legs and his hamstrings tighten up and it can be painful. He stated that he will ask for his prescribed 650 MG of acetaminophen for the pain. When speaking about everyday stresses with the client, he stated that he doesn’t have a lot of stress but gets irritated when that staff turn on the lights every morning at 6:30 am. When asked if there was anything that he does when he notices that he is stressed, the client mentioned that when he was younger he would travel to Vedic City in Iowa and practice with the Maharishi meditating. He says that meditating has been very helpful in his adult life. The client also mentioned that he liked to follow the Maharishi lifestyle and eat only organic foods but it is not possible to follow that when residing at a long term care facility. Other things that he does to distress are look at his pictures that he has on his shelf in his room. The one that helps him the most is a black and white picture of him in a small airplane with his flight instructor standing on the wing. The client use to pilot planes when he was younger. When the client was asked if he was religious and he explained that he is Methodist but hasn’t been to church in about 5 years. He did state that he does pray occasionally. The client stated that is not afraid of dying but he is afraid of falling. He then joked that maybe it’s not so much the falling but maybe it’s the landing. When assessing the client’s vitals it was noted that he has slightly elevated blood pressure of 129/84 and could be cause for concern of pre-hypertension. Metoprolol tartrate 25 mg Orally BID Hypertension It is noted in his chart that the client is given a 25 mg tablet of metoprolol tartrate orally twice a day for hypertension. His respirations were within normal range at 18 respirations per minute. SaO2 was at 86%. The client’s temperature was taken orally and was 97.6  °F. The client is 6 feet and 1 inch tall and weighs 257 lbs. The client has a BMI of 33.9. The client received a vaccination for influenza on 10/16/13. The clients chart states that he requires assistance with many daily activities. He is dependent on help with dressing, and bathing. When asked, the client stated that it is challenging to get dressed and undressed due to the stiffness in his arms and legs. The client is on a regular diet and states that he  doesn’t have any difficulty swallowing foods and doesn’t require help with feeding. When asked about appetite he said that sometimes he doesn’t have much of an appetite but he believes that is due to the medications that he is taking. The client explains that he is not aware of having any food allergies. He also stated that after eating he does not experience sensations of nausea/vomiting, but does encounter heartburn/indigestion occasionally, which he takes 30 ml an antacid suspension. He is also given one multivitamin orally daily for supplement. Antacid Suspension 30 ml Orally Every 6 hours Supplement heartburn Multivitamin 1 tablet Orally o.d. Supplement When the client was asked about dentures he stated that he does not have dentures even though dentures were noted in his chart. He states he needs aid in transferring from bed to a chair and with toileting. When asked about the character of his stools he explained that both consistency and color were normal. The client also stated that he does not need the help of laxatives. Noted in the client’s chart he is given a 100 mg capsule of Docusate sodium orally 2 times a day to help with constipation. Docusate sodium 100 mg capsule Orally BID Constipation The client does not have any history of kidney or bladder disease. He claims that the frequency, amount and color of his urine are normal. He also claims that he does not have any difficulty voiding and there is no pain or burning while urinating. According to the CNA, the client is able to stand,  holding the hand rails, while urinating. It is noted in the clients care plan that he is urinary incontinent which is related to impaired mobility and PRN straight catheter needed for intermittent retention secondary to BPH. The client is given one 0.4 mg of Tamsulosin HCL orally a day for BPH (benign prostatic hyperplasia). Tamsulosin HCL 0.4 mh Orally o.d. BPH The client needs assistance with bathing as well. The client also has a DNR order. Parkinson’s disease (paralysis agitans) is a progressive disorder of the nervous system that affects ones mobility. According to Hubert and VanMeter, Parkinson’s disease is a â€Å"dysfunction of the extrapyramidal motor system that occurs because of progressive degenerative changes in the basal nuclei, principally in the substantia nigra.†(UMMC, 2012) The substantia nigra is the primary area of the brain that is affected by Parkinson’s disease (PD). (UMMC, 2012) The substantia nigra is comprised of a specific set of neurons that send chemical signals, called dopamine. Dopamine then travels to the striatum, responsible for balance, control of movements, and walking, by means of long fibers called axons. (Okun, 2013) These regular body movements are controlled by the activity of dopamine on these axons. With PD the neurons in the substantia nigra break down and die causing the loss of dopamine, which in turn causes the nerve cells in the striatum to trigger excessively. The excessive firing of neurons makes it impossible for one to control their movements, a sign of Parkinson’s disease. (Okun, 2013) According to the Parkinson’s disease Foundation (2014): As many as one million Americans live with Parkinsons disease, which is more than the combined number of people diagnosed with multiple sclerosis, muscular dystrophy and Lou Gehrigs disease. Also approximately 60,000 Americans are diagnosed with Parkinsons disease each year, and this number does not reflect the thousands of cases that go undetected. An estimated  seven to 10 million people worldwide are living with Parkinsons disease. Incidence of Parkinson’s increases with age, but an estimated four percent of people with PD are diagnosed before the age of 50 and men are one and a half times more likely to have Parkinsons than women. (p 1) Since PD is a progressively degenerative disease the signs and symptoms change over time and vary from person to person. A widely used clinical rating scale is the Hoehn and Yahr scale (HY); this helps to identify signs and symptoms in the various stages of Parkinson’s disease. (MGH, 2005) Early stages, like HY’s stage one, of Parkinson’s disease the symptoms are usually mild and appear unilateral. There may be changes in facial expressions, posture and locomotion; these symptoms are usually untimely and bothersome but not disabling. As the disease progresses, into stage two of the HY scale, it may begin to affect ambulation and be noticeable bilaterally with minimal disability. (MGH, 2005) As symptoms worsen, as in stage three of the HY scale, there is considerable slowing of body movements, early impairment of equilibrium with walking and standing and generalized dysfunction that is moderately severe. The Hoehn and Yahr scale’s stage four explains that signs and symptoms are severe but the person can still walk to a limited extent. (MGH, 2005) Rigidity and bradykinesia become factors in mobility. In stage five the person is unable to walk or stand so is bedridden or confined to a wheelchair. This stage is referred to as the â€Å"cachectic stage †. Constant nursing care is required in stage five (Costa and Quelhas, 2009). There are many complications that are associated with PD; one can be difficulty swallowing (dysphagia), likely due to the loss of control of muscles in the throat. (UMMC, 2012) Drooling can occur since saliva may accrue in the mouth due to dysphagia. Difficulty swallowing can also lead to malnourishment, but also poses a risk for aspiration pneumonia (Leopold and Kagel, 1997). Constipation can be another complication as to the slowing of the digestive tract. Parkinson’s disease can also cause urinary retention and urinary incontinence. Dementia and difficulty thinking comes in later stages of PD. (University of Maryland Medical Center, 2012) Depression is very common in patients with Parkinsons. The disease process itself causes changes in chemicals in the brain that affect mood and well-being. Anxiety is also very common and may be present along with depression (University of Maryland Medical Center, 2012). Sleep problems  and sleeping disorders are also associated with PD, with this comes fatigue. Some patients may experience feeling light headed when standing due to the drop in blood pressure (orthostatic hypotension). Pain can also be another symptom related to Parkinson’s disease (Okun, 2013). There is not yet a cure for Parkinson’s disease but there are treatments that can help alleviate the symptoms. The most commonly used is drug therapy. Medications can help with difficulty with movement, walking and controlling tremors by increasing the brains amount of dopamine. (University of Maryland Medical Center, 2012) The most common and most effective Parkinson’s disease drug is Levodopa. This is a natural chemical that passes into your brain and is converted to dopamine (Okun, 2013). There is also surgical procedures available, deep brain stimulation. With this procedure the surgeon implants electrodes into a specific location in the patient’s brain. A gen erator is implanted in the patient’s chest, which is attached to the electrodes. This generator sends electrical impulses to the patient’s brain, which may lessen the symptoms of Parkinson’s disease. (University of Maryland Medical Center, 2012) Other ways that help control the effects of PD is a healthy diet. Constipation is a complication associated with PD, so a diet that is balanced with whole grains, fruits and vegetables helps to manage this complication. Balance, coordination, flexibility and muscle strength deteriorate with PD so, exercise is encouraged. Exercise also helps with decreasing anxiety and depression. The client exhibits many of the discussed signs and symptoms of Parkinson’s disease. The client experiences resting tremors, bradykinesia, mask like face (hypomimic), slowed speech and is in a wheelchair. He scores very poorly according to the Hoehn and Yahr scale. The client is on medications to help diminish the signs and symptoms of Parkinson’s disease. Impaired physical mobility level 3, related to bradykinesia, ak inesia, neuromuscular impairment motor weakness, pain and tremors. (Berman Snyder, 2012) Evidenced by lack of decisive movement within physical environment, including movement in bed, transfers, and ambulation. Limited range of motion (ROM). Decreased muscle stamina, strength and control. Limitation in independent, purposeful physical movement of the body and impairment unilaterally on the right side. Due to the muscular and neuromuscular weakness related to Parkinson’s disease, evidenced by it being difficult for the patient to ambulate. The client has a defect of extrapyramidal tract, in the basal ganglia, with loss of the neurotransmitter dopamine. (Berman Snyder, 2012) Classic triad of symptoms: tremor, rigidity, bradykinesia (Jarvis, 2012). Tremors associated with paralysis agitans make it difficult maneuver. Tremors cease with voluntary movement and during sleep (VanMeter and Hubert, 2014). Immobility is an expected human response to Parkinson’s disease. The client’s immobility puts him at risk for thrombophlebitis, skin breakdown, pneumonia and depression. Immobility impedes circulation and diminishes the supply of nutrients to specific areas. As a result, skin breakdown and formation of pressure (decubitus) ulcer can occur (Berman and Snyder, 2012). Immobility also promotes clot formation. Self-care deficits related to neuromuscular impairment, immobility, decreased strength, and loss of muscle control and lack of coordination, ridgity and tremors. Self-care deficits, dressing, hygiene and toileting, evidenced by tremors and motor disturbance. The client lacks the ability to cleanse his body, comb his hair, brush his teeth and do skin care. . The client is also unable to dress himself satisfactory. He does not have the capability to fasten his clothes. The patient is assisted with ADL’s. Patient is incapable to bathe, dress or brush teeth without aid. Patient occasionally needs assistance with feeding. Assistance is also required with toileting. Aid is needed with ADL’s because of the lack of coordination and for safety. This nursing diagnosis is important because it ensures hygiene, improves quality of life, and promotes dignity, self-worth, independence and freedom. Risk for falls related to decreased mobility, a nd unsteady gait secondary to sedentary lifestyle and Parkinson’s disease. Patient uses a wheelchair and ambulates with a walker. Patients gait is impaired due to Parkinson’s disease. Festination, or a propulsive gait (short, shuffled steps with increasing acceleration), occurs as postural reflexes are impaired, leading to falls (VanMeter and Hubert, 2014). Falls also result in psychological implications for the patient with a decrease in self-confidence and a fear of further falls. This contributes to a decrease in mobility and culminates in a significant reduction in quality of life (Jarvis, 2012). Impaired bowel elimination/constipation related to medication, physical disability and decreased activity. Evidenced by the client not passing stools daily. Medications prescribed to patient for Parkinson’s disease attribute to constipation. The patients experience with immobility is also a  contributing factor for constipation. This nursing diagnosis is important because it allows nursing staff to monitor the patient’s bowel movements and avoid fecal impaction. Imbalanced nutrition less than body requirements related to tremors, slowing the process of eating, difficulty chewing and swallowing. Evidenced by the client occasionally needing assistance with eating. Pressure sores develop more quickly in patients with a nutritional deficit. Proper nutrition also provides needed energy for participating in an exercise or a rehabilitative program. The goal is to optimize the client’s nutritional status. Impaired verbal communication related to decreased speech volume, decreased ability to speak, stiff facial muscles, delayed speech, and inability to move facial muscles. Evidenced by lack of expression on the client’s face, client’s hindered speech. Loss of dopamine can affect the facial muscles, making them stiff and slow and resulting in a characteristic lack of expression. Speech impairment is referred to as dysarthria and is often characterized as weak, slow, or uncoordinated speaking that can affect volume and pitch. Difficulty speaking and writing because of tremors, hypophonia, and â€Å"freeze† incidents. This is an expected consequence of Parkinson’s disease. Nursing Care Plan- Alteration in impaired physical mobility- Parkinson’s disease Related to: Goals Intervention Bradykinsia Client will use a walker to go to breakfast in the mornings and not need assistance with transfers. Client will be able to perform all active ROM by 3 months Examine current mobility and observation of an increase in damage. Do exercise program to increase muscle strength. Perform passive or active assistive ROM exercises and muscle stretching exercises to all appendages. To promote increased venous return, prevent stiffness, and maintain muscle strength and endurance. Without movement, the collagen tissues at the joint become ankylosed (permanently immobile) (Berman Synder, 2012) Akinesia Client will gain power of voluntary movements. Joint contractures will not occur. Assess the possibility of deep brain stimulation. Refer to physical therapy. When the muscle fibers are not able to shorten and lengthen, eventually a contracture forms, limiting joint mobility (Berman Synder, 2012) Tremors Client’s tremors will decrease. Encourage deep breathing, imagery techniques and meditation. Encourage holding an object in hand Suggest holding the arm of the chair. Stimulating the brain by concentrating on breathing may cease tremors. (www.theparkinsonhub.com) Pain Client will not experience pain 4 on a scale of 0-10 Before activity observe for and, if possible, treat pain. Assess patients willingness or ability to explore a range of techniques aimed at controlling pain. Administer pain medication per physician orders. Encourage/assist to reposition frequently to position of comfort. Pain limits mobility and is often exacerbated by movement. (www.ptnow.org) Nursing Care Plan- Alteration in Skin Integrity, Impaired: Risk for Pressure Sores; Pressure Ulcers, Bed Sores; Decubitus Care Related to: Goal Interventions Rationale Neuromuscular impairment Client will be free of any pressure ulcers for length of long term stay. Monitor site of skin impairment at least once a day for color changes, redness, swelling, warmth, pain or any other signs of infection. Pay special attention to high risk areas and ask client questions to determine whether he is experiencing loss of sensation. Apply barrier cream to peri area/ buttocks as needed. Use ROHO cushion on wheelchair. Checking skin once a day will ensure that skin stays intact. (Jarvis, 2012) Immobility Client will be able to express s/s of impaired skin. Teach skin and wound assessment and ways to monitor for s/s of infection, complications and healing. Use prophylactic antipressure devices as appropriate Early assessment and interventions may help complications from developing. To prevent tissue breakdown. (Jarvis, 2012) Nursing Care Plan- Self Care Deficits Related to: Goal Intervention Rationale Immobility Client will assist with bathing, grooming, dressing, oral care and eating daily. Assist client with bathing, grooming, dressing, oral care and eating daily. Use high back wheelchair. The effectiveness of the bowel or bladder program will be enhanced if the natural and personal patterns of the patient are respected. Loss of muscle control and lack of coordination Client will improve muscle control and coordination in all extremities for the length of long term stay. Client will walk to dining room and in hallways- 5 mins a day 5 days a week. Use consistent routines and allow adequate time for patient to complete tasks. Assist client with ambulation. This helps patient organize and carry out self-care skills. Tremors Client will be able to assist with dressing. Provide appropriate assistive devices for dressing as assessed by nurse and occupational therapist. Encourage use of clothing one size larger. Teach and support the client during the clients activities Apply extensions on breaks with ball grips The use of a button hook or of loop and pile closures on clothes may make it possible for a patient to continue independence in this self-care activity. Ensures easier dressing and comfort. Grips will be easier to grasp with tremors. Neuromuscular impairment Client will be clean, dressed, well groomed daily to promote dignity and psychosocial well-being. Assist with shower as needed. Assist with daily hygiene, grooming, dressing, oral care, and eating as needed. This promotes dignity and psychosocial well-being. Nursing Care Plan- Falls, risk for Related to: Goal Intervention Rationale Decreased muscle tone Client will express an understanding of the factors involved in possible injury. Educate the client about what makes them at risk for falls. Bed should be in lowest position. Provide assistance to transfer as needed. Reinforce the need for call light. If the client is educated and shows an understanding of the factors involved with falls, they are less likely to fall. Prevent fall. Nursing Care Plan- Impaired Bowel elimination/constipation Related to: Goal Intervention Rationale Inactivity, immobility Client will have soft formed stool every other day that are passed without difficulty. Encourage physical activity and regular exercise. Adjust toileting times to meet client’s needs. Report changes in skin integrity forum during daily care Ambulation and/or abdominal exercises strengthen abdominal muscles that facilitate defecation. low-fiber diet Evaluate usual dietary habits, eating habits, eating schedule, and liquid intake. Initiate supplemental high-protein feedings as appropriate. Change in mealtime, type of food, disruption of usual schedule, and anxiety can lead to constipation. Proper nutrition is required to maintain adequate energy level. Diminished muscle tone Encourage isometric abdominal and gluteal exercise Apply skin moisturizers/barrier creams as needed To strengthen muscles needed for evacuation unless contraindicated. (http://www.gutsense.org) Medications Encourage liquid intake of 2000 to 3000 ml per day To optimize hydration status and prevent hardening of stool (VanMeter Hubert, 2014) My thinking about my resident has definitely changed since the initial day when I conducted a health history assessment on him. I knew that first day that I was going to appreciate getting to know this resident because of how smoothly the conversation flowed. This resident had some amazing stories to tell. I absolutely adore that fact that he and his wife have been married for 48 years. I enjoyed listening to him remember what life was like before being diagnosed with Parkinson’s disease, it appeared to lighten his spirit. I feel very fortunate to have been given the opportunity to care for such a genuine soul. My whole clinical experience was a positive one. I realized that if I lacked the knowledge about a particular task to ask for help. I liked the fact that clinicals was hands on and that I gained experience in a long term health care facility. Another thing that this clinical rotation  taught me was that it takes an exceptional type of person to go into geriatric nursing. Probably the number one thing that I’m going to take away from this clinical experience is the total importance of dignity. I too will be old someday and I applied the golden rule to this experience. I treated others as I want to someday, and hopefully, will be treated. What a fantastic learning experience. References: Berman, A., Snyder, S. (2012). Kozier Erbs Fundamentals of Nursing: Concepts, Process, and Practice. Upper Saddle River: Pearson Education. Coleman, J., (September 1, 2013) Meditation Mitigating Parkinsons Symptoms. Retrieved from http://www.theparkinsonhub.com/your-quality-of-life/article/meditationmitigating-parkinsons-symptoms.html Costa, M. Quelhas, R. (2009). Anxiety, Depression, and Quality of Life in Parkinson’s Disease. The Journal of Neuropsychiatry and Clinical Neurosciences 2009; 21:413-419. Jarvis, C. (2012). Physical Examination Health Assessment. St. Louis: Elsevier Kegelmeyer, D., (July 1, 2013) Functional Limitation Reporting (FLR) Under Medicare: Tests and Measures for High-Volume Conditions. Retrieved from http://www.ptnow.org/FunctionalLimitationReporting/TestsMeasures/Default.aspx Leopold N., Kagel M. (1997). Pharyngo-esophageal dysphagia in Parkinson’s disease. Dysphagia 1997; 12:11–18 Massachusetts General Hospital (MGH) (May, 2005) Hoe hn and Yahr Staging of Parkinsons Disease, Unified Parkinson Disease Rating Scale (UPDRS), and Schwab and England Activities of Daily Living. Massachusetts General Hospital. Retrieved March 2, 2014, from http://neurosurgery.mgh.harvard.edu/functional/pdstages.htm#HoehnandYahr Okun, M. (2013). Parkinsons Treatment: 10 Secrets to a Happier Life. CreateSpace Independent Publishing Michael S. Okun M.D. Parkinson’s disease Foundation (2014, March) Understanding Parkinson’s. Parkinson’s Disease Foundation. Retrieved March 2, 2014, from http://www.pdf.org/en/understanding_pd University of Maryland Medical Center (2012, September) Parkinson’s disease. University of Maryland Medical Center. Retrieved March 2, 2014, from http://umm.edu/health/medical/reports/articles/parkinsons-disease#ixzz2upFLCggw VanMeter, K. C., Hubert, R. J. (2014). Goulds Pathophysiology for the Health Professions. St. Louis: Elsevier.