Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words

Gene Prediction - Lab Report Example This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039. The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%. Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3 ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA. Fasta formatted sequence was

Information Technology Analysis Term Paper Example | Topics and Well Written Essays - 1000 words

Information Technology Analysis - Term Paper Example According to Information Systems Audit and Control Association (ISACA) the five major components of IM / IT governance are:strategic alignment, value delivery, resource management, risk management and performance measurement (ISACA, 2009). Strategic alignment: In a health care organization,suppose a hospital, strategic alignment is when the corporate business goals of the hospital and its departmental or functional goals are aligned with each other. More specifically to achieve strategic alignment, what the top management has to work upon is making a set of attainable goals and objectives and communicate them to all the subordinate department heads so that the narrowed down departmental operational goals are aligned with the more broader corporate ones. As a result when IT operations help to achieve the hospital’s overall desired strategic goals, whether they are providing best quality healthcare services to patients, maintaining healthy hospital environment, providing fast an d efficient healthcare services, etc., the health care quality to the end customer (patients) will be improved. Value delivery: Values are the organization’s fundamental underlying aims and goals based on which the IT strategies, policies and plans are structured so that best possible decisions can be made to guide operations. IT governance delivers maximum value and improves healthcare quality when while making an IT based decision, the alternative with higher value is chosen. For example, one decision might increase customer satisfaction; the second alternative decision might increase hospital’s revenue while the third might increase both. Logically, the third alternative should be opted for, so quality is improved with best value delivery. Value delivery is contingent to management’s decision making. Resource management: It is quite obvious that IT departments or projects require a reasonable amount of resource investment including human resources, capital, t ime, space, etc. IT governance involves managing resources and making intelligent decisions so that the quality of health care is improved with optimum resource allocation i.e. getting maximum value from resources allocated at lowest cost so that healthcare is improved (Weill & Olson, 1989). Risk management: Risk in IT governance has three levels: innovation, agile execution and cost efficiency (Mueller et al, 2008). For an IT decision to be at its least risk so that healthcare is improved the most effective level is cost efficiency because on the scale of risk versus time elapsed, cost efficiency is when the IT decision bears least risk as compared to the other two levels. Although, it is to be noted that for every new IT project in any healthcare organization the risk level is highest if the idea is supposed to bring a strikingly abrupt change initiative. For example: shiftinga hospital’s completely manual patient-file-system to an enterprise databasewill drastically improv e healthcare quality but will have high risk involved. Again, it is the management’s decision that evaluates value versus feasibility. The best decision is then, the one that maximizes value and improves healthcare quality minimizing risk to the least. Performance measurement: IT governance improves quality of healthcare when appropriate performance measures are used to evaluate whether the

Comparison of the entrepreneurial journey made by Skype and Groupon Essay

Comparison of the entrepreneurial journey made by Skype and Groupon - Essay Example Microsoft Corporation most recently acquired the company in 2011. It has operated as their wholly owned subsidiary system since then. However, the licensing and operations of the software continue to be provided by Skype Technologies (Markovich and Krieger, 2010). The company is a limited liability company. Skype was originally developed to offer voice over IP services (VOIP) from the first release in 2003. This provided users a means to make calls over the internet, computer to computer or from computer to telephone at reduced call rates. The company also offers services such as calling landline/mobile phones to and from Skype by offering a Skype Number to their users. The services offered are the main source of Skype’s revenue. Groupon is a globally known e-commerce marketplace, which connects millions of their subscribers with local merchants. This is done by offering a range of business activities, travel opportunities, sales of goods and services in more than 47 countries. The company was launched in November 2008 in Chicago. By October 2010, the company had over 35 million users (registered). Andrew Mason created the original idea behind Groupon. Groupon, Inc. is the world’s largest online coupon provider currently. Both companies have received numerous takeover offers but not all have responded the same.

Information Technology Analysis Term Paper Example | Topics and Well Written Essays - 1000 words

Information Technology Analysis - Term Paper Example According to Information Systems Audit and Control Association (ISACA) the five major components of IM / IT governance are:strategic alignment, value delivery, resource management, risk management and performance measurement (ISACA, 2009). Strategic alignment: In a health care organization,suppose a hospital, strategic alignment is when the corporate business goals of the hospital and its departmental or functional goals are aligned with each other. More specifically to achieve strategic alignment, what the top management has to work upon is making a set of attainable goals and objectives and communicate them to all the subordinate department heads so that the narrowed down departmental operational goals are aligned with the more broader corporate ones. As a result when IT operations help to achieve the hospital’s overall desired strategic goals, whether they are providing best quality healthcare services to patients, maintaining healthy hospital environment, providing fast an d efficient healthcare services, etc., the health care quality to the end customer (patients) will be improved. Value delivery: Values are the organization’s fundamental underlying aims and goals based on which the IT strategies, policies and plans are structured so that best possible decisions can be made to guide operations. IT governance delivers maximum value and improves healthcare quality when while making an IT based decision, the alternative with higher value is chosen. For example, one decision might increase customer satisfaction; the second alternative decision might increase hospital’s revenue while the third might increase both. Logically, the third alternative should be opted for, so quality is improved with best value delivery. Value delivery is contingent to management’s decision making. Resource management: It is quite obvious that IT departments or projects require a reasonable amount of resource investment including human resources, capital, t ime, space, etc. IT governance involves managing resources and making intelligent decisions so that the quality of health care is improved with optimum resource allocation i.e. getting maximum value from resources allocated at lowest cost so that healthcare is improved (Weill & Olson, 1989). Risk management: Risk in IT governance has three levels: innovation, agile execution and cost efficiency (Mueller et al, 2008). For an IT decision to be at its least risk so that healthcare is improved the most effective level is cost efficiency because on the scale of risk versus time elapsed, cost efficiency is when the IT decision bears least risk as compared to the other two levels. Although, it is to be noted that for every new IT project in any healthcare organization the risk level is highest if the idea is supposed to bring a strikingly abrupt change initiative. For example: shiftinga hospital’s completely manual patient-file-system to an enterprise databasewill drastically improv e healthcare quality but will have high risk involved. Again, it is the management’s decision that evaluates value versus feasibility. The best decision is then, the one that maximizes value and improves healthcare quality minimizing risk to the least. Performance measurement: IT governance improves quality of healthcare when appropriate performance measures are used to evaluate whether the

Engineering and Technology versus the natural Environment Essay

Engineering and Technology versus the natural Environment - Essay Example More recently of course, particularly during the late 19th century and early 20th century, a great array of scientific and technical discoveries were made which directly affected the way in which mankind viewed its environment as something to be changed to meet its needs and desires more conveniently. With engineering innovations came bigger houses, transportation systems, increased infrastructure and urban development. All of these things, once made apparent to mankind, did not remain novelties for long, but soon became seen as essential and a practical and fundamental aspect to civilised living, without which, human needs were not being met. The famous psychologist, Abraham Maslow explains this shift in thought in his ‘hierarchy of needs’ theory (1973). This theory explains that human needs are based upon which needs have already been met. At the bottom of the hierarchy, are the more physical human needs of shelter and nourishment. When these are difficult to come by, they are essentially all that is felt to be ‘needed’ by the individual. It is only when these needs are met, that the person feels a need for something else, which according to this theory, would be things like friendship and family. At the top of the hierarchy, are much more emotional needs such as self-actualisation, professional achievement and similar. The point is, as the world became built up and urbanised, and more tools and aesthetic factors thus became more common, people’s needs and expectations fundamentally changed.... de apparent to mankind, did not remain novelties for long, but soon became seen as essential and a practical and fundamental aspect to civilised living, without which, human needs were not being met. The famous psychologist, Abraham Maslow explains this shift in thought in his ‘hierarchy of needs’ theory (1973). This theory explains that human needs are based upon which needs have already been met. At the bottom of the hierarchy, are the more physical human needs of shelter and nourishment. When these are difficult to come by, they are essentially all that is felt to be ‘needed’ by the individual. It is only when these needs are met, that the person feels a need for something else, which according to this theory, would be things like friendship and family. At the top of the hierarchy, are much more emotional needs such as self-actualisation, professional achievement and similar. The point is, as the world became built up and urbanised, and more tools and aes thetic factors thus became more common, people’s needs and expectations fundamentally changed. Quite paradoxically, as the world has radically shifted in its desires to become increasingly civilised, archeologically impressive and technologically convenient, so too has the global interest in maintaining the natural environment. In recent decades, the adverse impact that technology and engineering has had upon the natural environment has become increasingly apparent and worrisome, as rainforest destruction is widespread and climate changes have reached shocking levels. Environmental groups have long been urging people to acknowledge the crucial importance of maintaining the natural environment, not just because of the vital role that its elements play in sustaining life, but because of its beauty and

Andrea Jung Ceo of Avon Essay Example for Free

Andrea Jung Ceo of Avon Essay Andrea Jung CEO of Avon By: Theresa Bell Andrea Jung CEO of Avon Abstract Andrea Jung has had many executive positions during her career as a vice president, merchandising manager, general merchandising manager, senior vice president and general merchandising manager, executive vice president and is now Avons CEO, a Fortune 500 company, and has been for almost the last decade. She is Avons first female CEO since it began in 1886. Andrea Jung has introduced new technology to the company and a new line of make-up. The cosmetics are now being sold in 143 different countries brining its profits up 41%. She gave Avon a revamp when she took over gaining trust, reliability, and gaining a competitive advantage over their competitors. She used a low-cost business-level strategy to gain the advantage over the competitors. The way Avon sales their product has not changed it still sales product by a door to door method, but they used new technology to go worldwide making the company more profitable. In 2011 Avon profit has dropped 18% making stakeholders question Andrea Jungs business-style management skill today. Avon needs a new plan inorder to gain the advantage over their competitors and this leads the stakeholders to question Andrea Jungs focus on management. Theresa Bell Keiser University Ron Phillips/Principles of Management December 6, 2011 Andrea Jung CEO of Avon From the start, Avon embraced the revolutionary concept of women’s economic empowerment, and this continues to be the driving force for Avon. Building on this rich heritage is Avon’s broader commitment to corporate responsibility and the company’s role as a global citizen. Added to the core commitment to women are two additional pillars of Avon corporate citizenship: philanthropy and environmental stewardship, supported by policies and programs across the companys entire business enterprise to ensure that Avon holds true to its mission and vision. (http://www. avoncompany. com/corporatecitizenship/corporateresponsibility/index. html) Andrea Jung is the Chairman and CEO of Avon and has been for almost a decade, in 2005 she ranked number 5 in the top 50 most powerful women at the age of 48 years old (http://money. nn. com/popups/2006/fortune/mostpowerfulwomen/7. html ). Andrea Jung took over as CEO, after Charles Perrin had problems within the company serving as its CEO for only two years. In 1999, Jung took over as CEO becoming Avons first female CEO since the company began in 1886. Since Jung has taken over as CEO, Avon has gone internationally selling worldwide, instead of just being sold to American women. Jung started a new line of make-up directed at teenage girls and college-age women to build Avons revenue and to gain younger customers. In doing this Jung has taken Avon in a different direction, Avon is now being sold in 143 countries, women selling directly to buyers, and selling worldwide this has brought more business into the company making it a more profitable company. Since Jung started selling worldwide nearly 40 percent of sales are from South and Central America. (http://www. notablebiographies. com/supp/Supplement-Fl-Ka/Jung-Andrea. html). Avon is now being sold in Mexico, Russia, and Canada, taking the company into a more competitive market. Jung has brought technology into the company focusing on the product sold to gain an advantage over their competitors. In her first five years as CEO, Andrea Jung gave Avon a badly needed facelift. Revenues rose from $5. 3 billion to $7. 7 billion, and profits nearly tripled The business style she used was low cost. Avon had taken the advantage over their competitors when Jung took over as CEO in 1999. Jung was responsible for the profits almost tripling using her business style of management. Today Andrea Jung is under fire by the stakeholders due to a drop in sales. Avons sales have dropped by 18% leaving them to question Jungs business management style. The company is in need of a turn around plan to gain the advantage over their competitors. The company is under two different investigations to find out if the company bribed officials overseas from Latin, and China. Jung is working on a long-term plan to fix the problems that the company is suffering from today. http://www. appleinsider. com/articles/11/10/28/apple_board_member_andrea_jung_facing_scrutiny_at_avon. html   http://www. avoncompany. com/corporatecitizenship/corporateresponsibility/index. html   http://money. cnn. com/popups/2006/fortune/mostpowerfulwomen/7. html http://www. notablebiographies. com/supp/Supplement-Fl-Ka/Jung-Andrea. html   http://www. appleinsider. com/articles/11/10/28/apple_board_member_andrea_jung_facing_scrutiny_at_avon. html.

Steganography, Cryptography And Watermarking

Steganography, Cryptography And Watermarking Steganography has been derived from Greek word Stego which means Covered and Graphia which means writing. Steganography is an ancient technique of covert communication. The earliest form of Steganography has been reported by the Chinese. The secret message was written in very fine silk or paper, and then it was rolled into a ball and covered with wax. The messenger would either swallow the ball or hide it in his nether parts. Herodotus has mentioned in one of his seminal works of history, Histories during the 400B.C about the tradition of secret writing. In his writings he has mentioned about the conflicts between Greece and Persia. A king named Histiaeus encouraged the Aristagoras of Miletus to revolt against the Persian king. He used to tonsure the head of his most trusted servants and tattooed the scalps with secret message and waited for the hair to grow. The servant used to travel between the borders without carrying anything contentious freely. At the reception end his head wou ld be tonsured again and the message will be conveyed. Similarly during the World War II, the Germans invented the use of microdots. Image containing great details were scaled down to the size of microdots. The German usage of secret sharing is regarded as the recent evolution of Steganography. Another example of Steganography is during the Vietman War were the captured US armed force showed hand gestures during a photo sessions to convey some military secrets. The field of Steganography is limitless and any kind of cover media can be used for carrying secret messages. Cover medias can be text, images (grey, binary, color), audio, video etc. An example is illustrated as follows. Siva and Adam dined happily. The following message is not simply a plain text but it carries a secret message within it. By extracting every second letter from each word we derive a secret message as follows. India Other methods of non technical Steganography is using lime and other citrus liquids to write secret data. The message will be imperceptible to the eye. When it is shown over a flame the writings will become perceptible. Steganography is method of information hiding. Steganography can be considered as an art as well as science for secret communication. The best way to explain the purpose of using Steganography is the Prisoner Problem. Now let us consider two prisoners Alice and Bob, and Wendy to be the warden. Now if Alice and Bob want to devise a plan for escaping then they got to communicate with each other. If Wendy is a passive warden then he wont interfere in there communication but if he is an active warden then he will interfere and extract the secret message sent. Hence Alice and Bob got to communicate in such a way that Wendy is not able to decipher there plan. This can be done by the technique of Steganography. Steganography is been used in order to enable secret communication. It is also being used by terrorist for covert communication which is potential for endangering our national as well as world security. Despite the ill effect there are positive sides of Steganography. For example a photographer can store the aperture size, future references etc while taking a picture. Steganography has a wide application in medical imaging were the details of the patients are embedded within the medical image. Similarly Steganography can be used for different friendly applications. It is also used for copy right protection using it along with Watermarking. The use of Steganography also has an important role in strengthening national security. Steganography is defined as secret hiding. It can also be regarded as secret sharing since messages can be shared secretly without being hacked or corrupted. COMPARISON BETWEEN CRYPTOGRAPHY, STEGANOGRAPHY AND WATERMARKING The other forms of data hiding are cryptography and watermarking. Cryptography is a technique in which the secret message is encrypted and sent in an unintelligent format. The basic difference between Steganography and cryptography is that Cryptography scrambles the data whereas Steganography just hides the data. Cryptography scrambles the secret data in such a way that it appears to be gibberish to any unintended user. The secret data to be communicated is a mixture of permutation and substitution and hence any unintended user cant receive the message. Steganography is different from Cryptography. Steganography rather hides the data whereas Cryptography encrypts the data. Steganography provides much more security when compared to cryptography because there is no chance of any unintended user to know that a message is being sent whereas in Cryptography there will always be a suspicion that a message is being sent. Hence these are more prone to be hacked or suppressed. Watermarking is generally used for authentication and copyrights protection. Watermarking can be used for creating a image in order that it is recognizable. It can also be used to mark a digital file so that it is intended to be visible (visible watermarking) or visible to its creator (invisible marking). The main purpose of watermarking is to prevent the illegal copying or claim of ownership of digital media. CHARACTERISTICS OF STEGANOGRAPHY, CRYPTOGRAPHY AND WATERMARKING The common characteristic between Steganography, Cryptography and Watermarking is that they transmit the secret information in such a way that only the receiver is able to decrypt the data. These techniques had been prevalent during the ancient times have been transported to the digital world. It has become nearly impossible to extract or detect the secret messages. In digital domain Steganography and watermarking have a tie and it is majorly used in digital images. These have other uses as well. Both cannot exist by themselves and hence they require cover objects. Steganography requires a cover media to carry the secret information and watermarking requires a carrier object which it is intended to protect. These similarities create a link within them and hence some modifications can lead the transportation from one technique to another. Due the similarities present between these it is difficult to distinguish between the both but actually there is a remarkable difference between the m. Cryptography encrypts data in two methods secure or unbreakable (e.g. One-time pad) systems and breakable (e.g. RSA) systems. Through both the systems communication carried out is known to all. But it is time consuming and often fruitless to crack a code. The robustness of the code lies upon the difficulties faced while reversing the code in different permutations and combinations. Due to its robustness it is used for security purposes. For example Cryptography is used for online shopping, banking etc. The credit card number, expiration etc and other crucial informations are encrypted and sent so that an unintended user cant access the details. Steganography offers high carrier capacity keeping embedded message invisible and maintaining the fidelity of the cover media. The efficiency of the Steganographic method is that one shouldnt know that a media file has been altered in order for embedding. If the malicious user knows if there is some alteration the Steganographic method is defeated and less efficient. The embedded message is very fragile and hence if any modification is done to the stego image th e whole secret message is corrupted. The effectiveness lies on the ability to fool an unintended user. The layers of communication can be more than one layer. A secret message can be embedded with a digital image which in turn can be embedded within another digital media or video clippings. Watermarking is required in order for authentication and copyright protection of digital files. The embedded watermarking is required in an object to make it impossible to remove completely. If the embedded watermarking is removed, then the marked object is either distorted or destroyed making it useless for anyone. This is the reason why watermarking is more robust when compared to the other image processing techniques, such as compression, cropping, rotation etc. hence even if a tiny bit of information is extracted by modification and tempering the rightful owner can still claim ownership. If the owners name is embedded in the digital image and the particular image then the original information is tampered and destroyed. Unlike Steganography, it is acceptable for everyone one to see the watermark embedded in it including the invisible ones. COMBINED EFFORTS OF STEGANOGRAPHY, CRYPTOGRAPHY AND WATERMARKING Cryptography is used as a paisano of the other two data hiding techniques. Data is encrypted in both the techniques in order to increase the randomness of the Steganography to avoid the statistics-based attacks and to protect the hidden data in watermarking. Commonly it is a practice to first encrypt the data and then use any one of the embedded techniques. The importance of watermarking can be stated as follows. Suppose Rs 100 bill is introduced in December 2009 then watermarking is required in order to prevent illegal copies. If the bill is shown in light a small image will appear within the large image. The watermarking is actually a part of the large paper and is visible on both sides. Hence it becomes difficult to produce a paper with such features. In addition to these features some tiny writings which are invisible to the human eyes are present in the paper. A banker having the necessary equipments (magnifying glass) can tell the difference between the original bill and the fake bill. Steganography makes its play here. The tiny printing done on the bill represents Steganography. It is implemented in order to achieve high security. The tiny printing done in the paper cannot be copied since any commercial printer is incapable to print such a fine and thin print leading to black spots. These are the reasons why Steganography is used for high security. Cryptography is actually implemented in the bill. A serial number is been printed in the bill which may contain information about the location and date of bill is printed or any other confidential information. The unique serial number for each bill can be used for tracking purposes. Using Steganography, Cryptography and Watermarking it becomes impossible to reproduce Rs100 bill. It must be kept in mind that all three are different and have different functionality. REQUIREMENTS OF STEGANOGRAPHY Any digital media can be used as a cover media. The cover media can be a text, image (color, gray), audio or video etc. Cover media is required in order to hide and carry the information. Usually digital images are required in order to hide secret messages. The secret message is hidden within the digital image. After the message is embedded within the cover media An innocuous image consisting of scenery, people and other objects are the nominees for cover media. The availability of natural images is not a problem due to the affordable price of digital cameras nowadays. Natural images are the best candidates for cover image since they have higher resolution providing flexibility and other necessary need. Images are selected because the cover media is selected depending upon how the human visual system works. The gray image consists of pixels with intensity value from 0 to 255. The human eye cannot differentiate between a pixel intensity of 244 and 245. It will appear both the pixel intensities to be same. Also natural image s contains lots of noise and hence there is lots of pixel value intensity difference especially in the edges. This variation in the pixel intensity is known as randomness and can be exploited to embed the data without providing any suspicion to human eye. The human visual system wont be able to distinguish between the image before modulation and the image after modulation. The secret data is embedded within the cover image. The resulting image is called a stego-image. The stego-image will appear to be the same as the original image. The human eye cannot usually distinguish between the stego-image and the original image except there is a significant change between the images. In that case the Steganographic method employed is ineffective. Hence there are certain Stego-system criteria which we have to follow while doing a Stegagraphic implementation. They are stated as follows. The major criteria of Steganography that the cover media shouldnt be significantly altered or modified. The embedded data should be directly encoded in the cover and not in the header or wrapper. The embedded data should be immune to modifications of the cover. That is if the cover media under goes any change then data embedded within it should be unaltered. During transmission there are chances of noise to occur and hence distortion due to noise cannot be eliminated. Due to this issue error coding algorithms should be included where ever it is required. It is advisable to avoid the suspicious portions while embedding the message in the cover. This because after embedding in these regions they become open to suspicion. For example by embedding in smooth portions of the image, the resultant image becomes distorted and open to suspicion. Hence such portions are often avoided and portions where there is variation in the pixel intensity are preferred. The embedding efficiency must be improved. Efficiency of the embedding capacity depends upon the number of pixels in the image used for embedding purposes. The stego-image should be robust to steganalysis. Steganalysis is a method of identifying the difference between the original image and stego-image. Using steganalysis one can derive the information about the secret message. The stego-image should reassemble the original image and there should be any suspicion. The cover image should have high carrier capacity. That is the embedding capacity should be large. The amount of information present in the image should be resistant to distortion and should be comparable to the number of pixels present in the image. The three basic requirements of Steganography are robustness, capacity and imperceptibility. All these requirements should be satisfied for having an effective Steganographic method.